ID: 1027691566 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:81353411-81353433 |
Sequence | TCTAGATCACTAGCAAGATC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 945 | |||
Summary | {0: 1, 1: 2, 2: 45, 3: 263, 4: 634} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1027691563_1027691566 | 11 | Left | 1027691563 | 7:81353377-81353399 | CCCAGATGTTCTTCGGGCTTCTT | No data | ||
Right | 1027691566 | 7:81353411-81353433 | TCTAGATCACTAGCAAGATCAGG | 0: 1 1: 2 2: 45 3: 263 4: 634 |
||||
1027691564_1027691566 | 10 | Left | 1027691564 | 7:81353378-81353400 | CCAGATGTTCTTCGGGCTTCTTG | No data | ||
Right | 1027691566 | 7:81353411-81353433 | TCTAGATCACTAGCAAGATCAGG | 0: 1 1: 2 2: 45 3: 263 4: 634 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1027691566 | Original CRISPR | TCTAGATCACTAGCAAGATC AGG | Intergenic | ||