ID: 1027691566

View in Genome Browser
Species Human (GRCh38)
Location 7:81353411-81353433
Sequence TCTAGATCACTAGCAAGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027691563_1027691566 11 Left 1027691563 7:81353377-81353399 CCCAGATGTTCTTCGGGCTTCTT No data
Right 1027691566 7:81353411-81353433 TCTAGATCACTAGCAAGATCAGG No data
1027691564_1027691566 10 Left 1027691564 7:81353378-81353400 CCAGATGTTCTTCGGGCTTCTTG No data
Right 1027691566 7:81353411-81353433 TCTAGATCACTAGCAAGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027691566 Original CRISPR TCTAGATCACTAGCAAGATC AGG Intergenic