ID: 1027691567 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:81353412-81353434 |
| Sequence | CTAGATCACTAGCAAGATCA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1027691563_1027691567 | 12 | Left | 1027691563 | 7:81353377-81353399 | CCCAGATGTTCTTCGGGCTTCTT | No data | ||
| Right | 1027691567 | 7:81353412-81353434 | CTAGATCACTAGCAAGATCAGGG | No data | ||||
| 1027691564_1027691567 | 11 | Left | 1027691564 | 7:81353378-81353400 | CCAGATGTTCTTCGGGCTTCTTG | No data | ||
| Right | 1027691567 | 7:81353412-81353434 | CTAGATCACTAGCAAGATCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1027691567 | Original CRISPR | CTAGATCACTAGCAAGATCA GGG | Intergenic | ||