ID: 1027691777

View in Genome Browser
Species Human (GRCh38)
Location 7:81355553-81355575
Sequence TGCTTCTCTGGTGCTACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027691777_1027691780 18 Left 1027691777 7:81355553-81355575 CCAGGTGTAGCACCAGAGAAGCA No data
Right 1027691780 7:81355594-81355616 AGATAGAATTCAGTTCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027691777 Original CRISPR TGCTTCTCTGGTGCTACACC TGG (reversed) Intergenic
No off target data available for this crispr