ID: 1027691780

View in Genome Browser
Species Human (GRCh38)
Location 7:81355594-81355616
Sequence AGATAGAATTCAGTTCAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027691777_1027691780 18 Left 1027691777 7:81355553-81355575 CCAGGTGTAGCACCAGAGAAGCA No data
Right 1027691780 7:81355594-81355616 AGATAGAATTCAGTTCAAAGTGG No data
1027691779_1027691780 -5 Left 1027691779 7:81355576-81355598 CCAATCTACTCTATCTGCAGATA No data
Right 1027691780 7:81355594-81355616 AGATAGAATTCAGTTCAAAGTGG No data
1027691778_1027691780 6 Left 1027691778 7:81355565-81355587 CCAGAGAAGCACCAATCTACTCT No data
Right 1027691780 7:81355594-81355616 AGATAGAATTCAGTTCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027691780 Original CRISPR AGATAGAATTCAGTTCAAAG TGG Intergenic
No off target data available for this crispr