ID: 1027692380

View in Genome Browser
Species Human (GRCh38)
Location 7:81364312-81364334
Sequence CACCCCAGTGACATTGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027692380_1027692382 13 Left 1027692380 7:81364312-81364334 CCTGGCTCAATGTCACTGGGGTG No data
Right 1027692382 7:81364348-81364370 TGTAATCTAATAAAGTTATTTGG No data
1027692380_1027692383 28 Left 1027692380 7:81364312-81364334 CCTGGCTCAATGTCACTGGGGTG No data
Right 1027692383 7:81364363-81364385 TTATTTGGCATAACAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027692380 Original CRISPR CACCCCAGTGACATTGAGCC AGG (reversed) Intergenic
No off target data available for this crispr