ID: 1027702807

View in Genome Browser
Species Human (GRCh38)
Location 7:81488922-81488944
Sequence TTAGAGTTCTACAGCAAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027702807_1027702812 22 Left 1027702807 7:81488922-81488944 CCAATTTTGCTGTAGAACTCTAA No data
Right 1027702812 7:81488967-81488989 ATTGGAATTAAGTAAGCACATGG No data
1027702807_1027702810 -3 Left 1027702807 7:81488922-81488944 CCAATTTTGCTGTAGAACTCTAA No data
Right 1027702810 7:81488942-81488964 TAAAGTTTCTGAGGTATGTTGGG No data
1027702807_1027702811 4 Left 1027702807 7:81488922-81488944 CCAATTTTGCTGTAGAACTCTAA No data
Right 1027702811 7:81488949-81488971 TCTGAGGTATGTTGGGAAATTGG No data
1027702807_1027702813 23 Left 1027702807 7:81488922-81488944 CCAATTTTGCTGTAGAACTCTAA No data
Right 1027702813 7:81488968-81488990 TTGGAATTAAGTAAGCACATGGG No data
1027702807_1027702809 -4 Left 1027702807 7:81488922-81488944 CCAATTTTGCTGTAGAACTCTAA No data
Right 1027702809 7:81488941-81488963 CTAAAGTTTCTGAGGTATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027702807 Original CRISPR TTAGAGTTCTACAGCAAAAT TGG (reversed) Intergenic
No off target data available for this crispr