ID: 1027702811

View in Genome Browser
Species Human (GRCh38)
Location 7:81488949-81488971
Sequence TCTGAGGTATGTTGGGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027702807_1027702811 4 Left 1027702807 7:81488922-81488944 CCAATTTTGCTGTAGAACTCTAA No data
Right 1027702811 7:81488949-81488971 TCTGAGGTATGTTGGGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027702811 Original CRISPR TCTGAGGTATGTTGGGAAAT TGG Intergenic
No off target data available for this crispr