ID: 1027711371

View in Genome Browser
Species Human (GRCh38)
Location 7:81605641-81605663
Sequence CTGTGTTCACAGATCGAATT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027711368_1027711371 25 Left 1027711368 7:81605593-81605615 CCAGGATTTGTTCTGGAGAAAAC No data
Right 1027711371 7:81605641-81605663 CTGTGTTCACAGATCGAATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027711371 Original CRISPR CTGTGTTCACAGATCGAATT CGG Intergenic
No off target data available for this crispr