ID: 1027712329

View in Genome Browser
Species Human (GRCh38)
Location 7:81620747-81620769
Sequence TGCCATCTTAATATATATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027712329_1027712331 -2 Left 1027712329 7:81620747-81620769 CCATCATATATATTAAGATGGCA No data
Right 1027712331 7:81620768-81620790 CATGGTCACTTTTCTCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027712329 Original CRISPR TGCCATCTTAATATATATGA TGG (reversed) Intergenic
No off target data available for this crispr