ID: 1027715116

View in Genome Browser
Species Human (GRCh38)
Location 7:81659739-81659761
Sequence GGTGCTTGTGCTCACCATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027715113_1027715116 -10 Left 1027715113 7:81659726-81659748 CCTCATCAGGGTTGGTGCTTGTG No data
Right 1027715116 7:81659739-81659761 GGTGCTTGTGCTCACCATTGGGG No data
1027715109_1027715116 1 Left 1027715109 7:81659715-81659737 CCTGCAGCCACCCTCATCAGGGT No data
Right 1027715116 7:81659739-81659761 GGTGCTTGTGCTCACCATTGGGG No data
1027715106_1027715116 26 Left 1027715106 7:81659690-81659712 CCTCGATGTCTTTCGACAGGAGC No data
Right 1027715116 7:81659739-81659761 GGTGCTTGTGCTCACCATTGGGG No data
1027715112_1027715116 -9 Left 1027715112 7:81659725-81659747 CCCTCATCAGGGTTGGTGCTTGT No data
Right 1027715116 7:81659739-81659761 GGTGCTTGTGCTCACCATTGGGG No data
1027715111_1027715116 -6 Left 1027715111 7:81659722-81659744 CCACCCTCATCAGGGTTGGTGCT No data
Right 1027715116 7:81659739-81659761 GGTGCTTGTGCTCACCATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027715116 Original CRISPR GGTGCTTGTGCTCACCATTG GGG Intergenic
No off target data available for this crispr