ID: 1027716003

View in Genome Browser
Species Human (GRCh38)
Location 7:81670734-81670756
Sequence TGTGAGCTATAGCTCTTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027716002_1027716003 5 Left 1027716002 7:81670706-81670728 CCATATGTCAAGAAACAGACTTG No data
Right 1027716003 7:81670734-81670756 TGTGAGCTATAGCTCTTCAGTGG No data
1027716000_1027716003 15 Left 1027716000 7:81670696-81670718 CCCTGATATACCATATGTCAAGA No data
Right 1027716003 7:81670734-81670756 TGTGAGCTATAGCTCTTCAGTGG No data
1027716001_1027716003 14 Left 1027716001 7:81670697-81670719 CCTGATATACCATATGTCAAGAA No data
Right 1027716003 7:81670734-81670756 TGTGAGCTATAGCTCTTCAGTGG No data
1027715999_1027716003 18 Left 1027715999 7:81670693-81670715 CCTCCCTGATATACCATATGTCA No data
Right 1027716003 7:81670734-81670756 TGTGAGCTATAGCTCTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027716003 Original CRISPR TGTGAGCTATAGCTCTTCAG TGG Intergenic
No off target data available for this crispr