ID: 1027721082

View in Genome Browser
Species Human (GRCh38)
Location 7:81742343-81742365
Sequence ATTTCACTATAGCAGAATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027721082_1027721086 24 Left 1027721082 7:81742343-81742365 CCATCATTCTGCTATAGTGAAAT 0: 1
1: 0
2: 1
3: 19
4: 275
Right 1027721086 7:81742390-81742412 TTAATTATATATTTTACTCTAGG No data
1027721082_1027721087 30 Left 1027721082 7:81742343-81742365 CCATCATTCTGCTATAGTGAAAT 0: 1
1: 0
2: 1
3: 19
4: 275
Right 1027721087 7:81742396-81742418 ATATATTTTACTCTAGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027721082 Original CRISPR ATTTCACTATAGCAGAATGA TGG (reversed) Intronic
902858883 1:19230261-19230283 ATTTTTCTATAGCAGAGAGATGG - Intronic
906592550 1:47040146-47040168 ATTGCAGTGTAGCATAATGAGGG + Intronic
906995540 1:50789677-50789699 ATTTCACTCTAGGGGCATGATGG - Intronic
907000857 1:50854182-50854204 TTTTCACTATAGAAGAATTTGGG - Intronic
907011353 1:50966562-50966584 AGTTCACTACAGCAGATTCAAGG - Intronic
907210115 1:52813856-52813878 ATTTCAAAATAGCTGAATGCTGG - Exonic
908792832 1:67800084-67800106 ATTTTAATATAGCAGAATACGGG - Intronic
909743377 1:79061571-79061593 AATTCACAATAGCAAAATCATGG + Intergenic
910043318 1:82881191-82881213 ATTTAAATAAATCAGAATGAAGG + Intergenic
910947048 1:92604781-92604803 GTTGCACTATAACATAATGATGG + Intronic
911815202 1:102341420-102341442 ACTTCACCTTAACAGAATGAAGG + Intergenic
912415587 1:109506481-109506503 ACTTCACGATAGAAGGATGAAGG - Exonic
912573116 1:110639138-110639160 ATTTCCTTATAGCAAAATGGTGG + Intergenic
912857866 1:113187799-113187821 ATCTTGCTATAGCAGCATGAGGG - Intergenic
918676526 1:187292971-187292993 ATACCACTTTAACAGAATGAAGG - Intergenic
919287269 1:195579579-195579601 ATATCACTTCAGCAGAAAGAGGG - Intergenic
919364801 1:196645090-196645112 ATACCAATATAACAGAATGAAGG + Intergenic
921786085 1:219231110-219231132 ATTTCAATATACCAGCAAGAAGG - Intergenic
923347413 1:233067796-233067818 AGTTCCCAACAGCAGAATGAAGG + Intronic
1063524351 10:6770787-6770809 TTTTCAGTATAACAGAATCATGG + Intergenic
1063973322 10:11396554-11396576 ATTTCCCACTTGCAGAATGAGGG + Intergenic
1066398887 10:35055341-35055363 AATTCACTACACCAAAATGAAGG + Intronic
1067463121 10:46472840-46472862 ATTTCAATATAACTAAATGATGG + Intergenic
1067624072 10:47911798-47911820 ATTTCAATATAACTAAATGATGG - Intergenic
1068753265 10:60621076-60621098 ATTTCAGTAGAGCAGATTGCAGG - Intronic
1070761963 10:79029555-79029577 TTTTCACTTGAGCAGGATGAAGG - Intergenic
1071964863 10:90842385-90842407 ATTTTGTTATAGCAGCATGAAGG + Intronic
1072482068 10:95818603-95818625 ATATCACTATAGAAGAAGGTGGG + Intronic
1074167295 10:110893993-110894015 ATTTCATTATATTGGAATGAGGG + Intronic
1074712244 10:116186917-116186939 TTTTCACCATAGCAGCATGGAGG - Intronic
1076269159 10:129135599-129135621 AATTCAATAAAGCAGAAAGAAGG + Intergenic
1076281326 10:129249105-129249127 ATTTCCCTATTTCAGAATCAGGG + Intergenic
1076767552 10:132644796-132644818 ATTTCACTTGAGCAGGATGAGGG - Intronic
1077777961 11:5292826-5292848 ATTGCATTATAGCAGAATGTAGG + Intronic
1078986075 11:16599908-16599930 ATTTCTTTTTACCAGAATGATGG - Intronic
1079938241 11:26644054-26644076 ATTTTATTATAGCAGCATAAAGG + Intronic
1083018080 11:59477064-59477086 ATTTCCTTAAAGCAGAATAAAGG + Intergenic
1083106598 11:60364321-60364343 CTGTCACTATAGGAGAAGGAAGG + Intronic
1083385656 11:62307314-62307336 TTTTCACAATAGCAAAATCATGG - Intergenic
1085490345 11:76910420-76910442 ATTTCACCCTATCAGAATAAAGG + Intronic
1086188227 11:84045753-84045775 ATTTCTCTACAGCAAAATAAAGG + Intronic
1086719580 11:90103754-90103776 ATTTCACCATAGAAGACAGATGG + Intergenic
1087360873 11:97157957-97157979 ATCTGATTATAGCAGAATTAAGG - Intergenic
1087666994 11:101061606-101061628 ATTTGTCTATAGCAGTATAAGGG + Intronic
1087726475 11:101723272-101723294 ACTTCATTATAGCAGCCTGAAGG + Intronic
1088462617 11:110097668-110097690 AATTAATAATAGCAGAATGAGGG + Intronic
1089184688 11:116606747-116606769 ATTTTATTATAGCAGCAGGAAGG - Intergenic
1089606444 11:119644196-119644218 ATTTCACTATCTCAGTCTGAGGG - Intronic
1090347938 11:126085924-126085946 AATTCTCTTTACCAGAATGAAGG + Intergenic
1090790051 11:130084300-130084322 ATATCACATTAACAGAATGAAGG - Intronic
1092042127 12:5394251-5394273 AGCTCACTATAGCTGAATGGTGG + Intergenic
1095522961 12:43089305-43089327 ACATCACAATAACAGAATGAAGG - Intergenic
1095938633 12:47711399-47711421 ATTTCACTTTGGGGGAATGAGGG + Intronic
1097760935 12:63463266-63463288 AATTCACAATAGCAAAATCATGG + Intergenic
1097870084 12:64594589-64594611 ATTTCCTTATAGCAGCATGTTGG - Intergenic
1098263159 12:68692145-68692167 TTTTCACTTTAGCAAGATGAAGG + Intronic
1098571243 12:71989769-71989791 ATTTCTTCATAGCAAAATGATGG + Intronic
1098849531 12:75578638-75578660 ATCTCACTTTACAAGAATGATGG + Intergenic
1099019609 12:77387223-77387245 ATTACACCTTAGCAGAATAATGG - Intergenic
1099318380 12:81113158-81113180 ATTTCAATATAACCGAATAAGGG + Intronic
1100665479 12:96747386-96747408 AGTTCATTATAGCAGATTAAAGG - Intronic
1101093293 12:101309874-101309896 CTTTAACTACTGCAGAATGATGG + Intronic
1101431722 12:104632661-104632683 ATTTCACCTCAGCAGACTGATGG - Intronic
1101792745 12:107943637-107943659 AGTTCACTATATAACAATGAAGG + Intergenic
1102134048 12:110557943-110557965 CTATCACAATAGCAGCATGAGGG + Intronic
1102417076 12:112773205-112773227 AATTCACAATAGCAAAATCATGG - Intronic
1102944711 12:116975999-116976021 ACATAACCATAGCAGAATGATGG - Intronic
1105351449 13:19619910-19619932 ATGTCTCTATGGGAGAATGAGGG + Intergenic
1105627447 13:22126563-22126585 ATTTCACTATATATAAATGAAGG - Intergenic
1106877647 13:34091374-34091396 CTTTCACCATAGCAAAATGTTGG - Intergenic
1106908510 13:34436570-34436592 TTTTCACTATAGCATAATCCTGG + Intergenic
1107455381 13:40550047-40550069 ATTTTATTATAGCAGCCTGAAGG - Intergenic
1107989797 13:45809597-45809619 ATTTTACAATATCAGAATGCAGG - Intronic
1109335123 13:60984424-60984446 ATTGCACTATAGCAGGTTAAGGG - Intergenic
1109869277 13:68311460-68311482 ATGACACTATATCAGAAAGATGG - Intergenic
1110078643 13:71282912-71282934 ACTTCACATTAACAGAATGAAGG - Intergenic
1110112801 13:71770432-71770454 ATTTAAGACTAGCAGAATGATGG - Intronic
1111316399 13:86566876-86566898 ATTTCAATATGGCAGCAGGAAGG + Intergenic
1111485889 13:88897406-88897428 AGCTCACTTTAGCAGAATCAGGG - Intergenic
1112685495 13:101820682-101820704 ACTTCACTAAAGCAGAAAAAAGG - Intronic
1112739834 13:102460074-102460096 ATTTCACAAGAGCATAATGGAGG - Intergenic
1113822000 13:113221325-113221347 AGGTCACTCTGGCAGAATGATGG + Intronic
1114277200 14:21157585-21157607 ATCTCACTATTGTAGAATGTGGG + Intergenic
1115109548 14:29805001-29805023 ATTTCCCTAGAGCAGAATTATGG + Intronic
1115514894 14:34175337-34175359 ATTTTTGAATAGCAGAATGATGG - Intronic
1116037974 14:39651354-39651376 ATATCACATTAACAGAATGAAGG + Intergenic
1116223801 14:42121596-42121618 AATTCACAATAGCAAAATGGTGG + Intergenic
1120554409 14:85911518-85911540 ATTTCACAATAGCAAAAACATGG + Intergenic
1120730950 14:88001114-88001136 ACATCACTTTAACAGAATGAAGG - Intergenic
1121993698 14:98585187-98585209 ATTTCACTACTGCAGAAGGCAGG - Intergenic
1122587227 14:102817381-102817403 TTTTCTCTAAAGTAGAATGATGG + Intronic
1123155277 14:106218815-106218837 ATTTCTCTTTAACAGCATGAGGG + Intergenic
1130220891 15:82018528-82018550 ATTTCCCTGAAGCAGAATCAGGG - Intergenic
1130391392 15:83458808-83458830 ATTTCACTGTAGGACAAAGAAGG + Intronic
1131818900 15:96251557-96251579 ATATCACTATAGCAGCAGTATGG + Intergenic
1133922912 16:10170299-10170321 TTTTCACTATTGCAGAAAGGGGG - Intronic
1135307410 16:21379038-21379060 ATTTCACTAAAGCAAAGTCAGGG - Intergenic
1136304155 16:29358176-29358198 ATTTCACTAAAGCAAAGTCAGGG - Intergenic
1136601649 16:31295992-31296014 ATATCACATTAACAGAATGAAGG - Intronic
1136997311 16:35199328-35199350 ATCACACTATAGCTGATTGAAGG + Intergenic
1138119294 16:54385598-54385620 ATTTCAGTAGAGAAGAATGGAGG + Intergenic
1138214368 16:55190315-55190337 ATTTCAATATAGCCTGATGAAGG + Intergenic
1139023174 16:62778167-62778189 ATATCACATTAGCAGAATAAAGG - Intergenic
1140881977 16:79206746-79206768 ATTTCATTATAGAAGTATCACGG + Intronic
1141008050 16:80371611-80371633 ATTTCACTGTGGCAGCATGATGG - Intergenic
1141248112 16:82329733-82329755 ATTTCTCCTCAGCAGAATGAGGG + Intergenic
1144406755 17:14959293-14959315 AATTCACTAAAGCAGCATGGAGG + Intergenic
1145856484 17:28163364-28163386 ATTTTACTGTAGCAAAATTACGG + Intronic
1146039810 17:29440958-29440980 ATATCACTTTATCAAAATGAAGG - Intronic
1146200508 17:30853391-30853413 ATGTCTCTATAGCAGAAGGTAGG - Intronic
1148515096 17:48209639-48209661 ATTTAACTATGGCTGAATTAGGG + Intronic
1150197126 17:63311507-63311529 TTTTCACTATAGAAAACTGAGGG - Intronic
1152183159 17:78837804-78837826 CTTTCACTAGAGCAGAATTTTGG - Intronic
1154393801 18:13968802-13968824 GTTTCATTATAGCAGTCTGAAGG - Intergenic
1155649933 18:28129259-28129281 ATTTAAAAATACCAGAATGATGG - Intronic
1157196317 18:45623008-45623030 ATTTCACCATACAAGCATGAGGG + Intronic
1157660666 18:49439542-49439564 ATTTCTCTTTAGCAGTATGCTGG - Intronic
1159153277 18:64548468-64548490 ATATCACATTAGCAGAATGAAGG - Intergenic
1159821218 18:73147114-73147136 ATTTCACTATAGCTCATGGATGG + Intergenic
1160329923 18:77981995-77982017 TTTTCACAATAGCAAAATCATGG + Intergenic
1161890715 19:7034354-7034376 TTTTCACTCTAGCAGAGTTAGGG + Intergenic
1161890735 19:7036377-7036399 TTTTCACTCTAGCAGAGTTAGGG - Intergenic
1161892800 19:7053089-7053111 TTTTCACTCTAGCAGAGTTAGGG + Intergenic
1161892820 19:7054841-7054863 TTTTCACTCTAGCAGAGTTAGGG - Intergenic
1162176950 19:8837741-8837763 TTTTTACTCTAGCAGAATTAAGG - Intronic
1162634962 19:11960830-11960852 ATTTCAGAATGGCAGAAAGAAGG - Intronic
1164023064 19:21326282-21326304 ATTTCACAATAGCAAAATCATGG + Intronic
1166024079 19:40063986-40064008 ATTTGACAATAGCAGCATAAAGG - Intergenic
926258461 2:11232685-11232707 CTTTGACTACATCAGAATGAAGG + Intronic
926622289 2:15057845-15057867 AATTCACAATAGCAAAATCATGG - Intergenic
928850785 2:35743158-35743180 CTATCACTACAGCAGCATGAGGG - Intergenic
929214174 2:39392953-39392975 ATTCCATTATAACAGAATAAAGG + Intronic
932078284 2:68687187-68687209 GTTTCACTATAGAAGTGTGACGG + Intronic
933239039 2:79898621-79898643 ATTTCTCATTAGGAGAATGAAGG + Intronic
933806331 2:86000507-86000529 TTTTCACTCTAGCAGAATAACGG - Intergenic
935797729 2:106661677-106661699 TTTTCAACATAGCAGAAGGATGG - Intergenic
936396741 2:112137498-112137520 ATTTTGCTATAGCAGTTTGAAGG + Intergenic
936941103 2:117885194-117885216 ATATCACATTAACAGAATGAAGG - Intergenic
937134153 2:119537900-119537922 ATTTGCCTAAAGAAGAATGAGGG + Intergenic
939271915 2:139950019-139950041 CTTTTATTATAGCAGTATGAAGG + Intergenic
939529973 2:143346559-143346581 GTTTCAGTATAGCATAATGTAGG - Intronic
940038888 2:149338717-149338739 ATTTTATTATAGCAGCCTGATGG + Intronic
941053827 2:160765219-160765241 ATTTAATTCTAGCAGAAAGATGG - Intergenic
942886755 2:180934767-180934789 ATCTGACTATCTCAGAATGAAGG + Intergenic
943034945 2:182731735-182731757 TTTTCAATATAGCAGCATGAAGG - Intronic
943850525 2:192716111-192716133 ATTTCACTAAAGAAGAATTATGG + Intergenic
944476239 2:200109817-200109839 ATTTCAAAATTTCAGAATGAGGG + Intergenic
945007880 2:205428585-205428607 ATTTTATTATAGCAGCTTGATGG + Intronic
945529563 2:210933665-210933687 ATTTCCCTATCACATAATGAGGG + Intergenic
945826284 2:214723897-214723919 AATTCACAATTGCAGAATCATGG + Intergenic
945986889 2:216362103-216362125 CTTATACTATTGCAGAATGATGG - Intronic
946975575 2:225145824-225145846 ATATCACATTAACAGAATGAAGG + Intergenic
947578159 2:231293231-231293253 TTTTCAATATGCCAGAATGAGGG - Intronic
1170675249 20:18473379-18473401 ATTCCACTACAGTAAAATGAAGG + Exonic
1171132868 20:22670567-22670589 ATATCACATTAACAGAATGAAGG + Intergenic
1171983409 20:31642886-31642908 ATTTCATTCTAACAGAATTAGGG - Intronic
1174739584 20:52999050-52999072 ATTTCAGACTAGCAAAATGATGG + Intronic
1177457113 21:21354910-21354932 ATTTCACTTTAGCAGAAAAAAGG - Intronic
1178052467 21:28763194-28763216 ATTTCTTTATAGCAAAACGATGG - Intergenic
1179373924 21:40832373-40832395 ATTTCCCTAAAAAAGAATGAGGG - Intronic
1179945893 21:44675294-44675316 ATATCACATTAACAGAATGAAGG + Intronic
949430393 3:3969264-3969286 ATGCCACTGTAGCAGAAAGATGG + Intronic
951928530 3:27937366-27937388 ATTCAAGTATAGCAGAGTGAAGG + Intergenic
953101097 3:39828899-39828921 AATTCACAATAGCAGAATCGTGG - Intronic
953593004 3:44278151-44278173 ATATCACATTAACAGAATGAAGG - Intronic
954503736 3:51048093-51048115 ATACCACAATAGCAGAATTAAGG + Intronic
956508712 3:69972021-69972043 ATTTCACTCCAGTGGAATGAAGG + Intergenic
958002846 3:87773003-87773025 AATTCACAATAGCAAAATCATGG - Intergenic
958100986 3:89010178-89010200 ATACCACATTAGCAGAATGAAGG + Intergenic
958257923 3:91346632-91346654 TTTTCACTAGAGCAGTTTGATGG - Intergenic
959436634 3:106322981-106323003 AATTCACAATAGCAAAATCATGG + Intergenic
959829079 3:110838669-110838691 ATATCACGTTAACAGAATGAAGG + Intergenic
960329025 3:116334613-116334635 ATATCACATTAACAGAATGAAGG + Intronic
961172586 3:124808570-124808592 ATTTCACCAAAACAGAATGGGGG + Intronic
961309467 3:125986092-125986114 ATTTTAATACAGCACAATGATGG - Intergenic
963185489 3:142411363-142411385 ATTAAACTCAAGCAGAATGAAGG - Intronic
963884822 3:150570200-150570222 ATTTGACTAGAGAAGAATAATGG + Intronic
964040145 3:152251801-152251823 ATTTCTCTATTGCATAATGATGG + Intronic
964586369 3:158308815-158308837 ATTTCATTTTCGCAGAATGGTGG + Intronic
964611133 3:158616562-158616584 ATATCACTTCAACAGAATGAAGG - Intergenic
966983705 3:185160976-185160998 AAAGCACTATAGGAGAATGAGGG + Intergenic
967448218 3:189592505-189592527 ATATCACATTAACAGAATGAAGG + Intergenic
968617396 4:1584170-1584192 ATTTGAATATATCAAAATGAAGG - Intergenic
969357497 4:6638989-6639011 TTTTGACTACAGCAGAATTAAGG - Intergenic
971099324 4:23445668-23445690 ATTTCATTGTAGCAGGATGGAGG + Intergenic
971182484 4:24342629-24342651 ATTTTACCATAGCTTAATGAAGG - Intergenic
971791149 4:31171350-31171372 AATTCACTGTAGCATAATAAAGG - Intergenic
974390930 4:61266829-61266851 ATTTTACTATTAAAGAATGATGG - Intronic
974904474 4:68038092-68038114 ATTTATCAATTGCAGAATGAGGG + Intergenic
976192048 4:82496917-82496939 ATTTTAACATAGCAGATTGAGGG + Intronic
977019583 4:91742877-91742899 AATTCACAATAGCAAAATCATGG - Intergenic
977065768 4:92313009-92313031 AATTCACAATAGCAAAATCATGG + Intronic
977672175 4:99708278-99708300 ATTTCACTATCGAAGAAAGATGG + Intergenic
978707889 4:111737976-111737998 ATTGCAGTATAGCTGAATCATGG + Intergenic
979106395 4:116694203-116694225 CTATCACTACAGCAGCATGAGGG - Intergenic
979582413 4:122376398-122376420 ATTTCATTATATCAGTATGGAGG - Intergenic
980063708 4:128158871-128158893 ATGTAACTATAGCACAATGCTGG + Intronic
982189290 4:152837201-152837223 AATTCACAATAGCAAAATCATGG - Intronic
984426248 4:179590764-179590786 ACTTCACTTTAGCAGAAGAAAGG + Intergenic
985945386 5:3178093-3178115 ATTTCATTACAGCAGAATGCAGG - Intergenic
986553731 5:8988365-8988387 ATATCACATTAACAGAATGAAGG - Intergenic
987485695 5:18522939-18522961 ATTTCAGTATATCAGAATTAAGG + Intergenic
987953868 5:24712119-24712141 ATTTCACTAAAGCAAAATGAGGG + Intergenic
988010887 5:25483167-25483189 ATCTCACAAAAGCAGAAGGATGG - Intergenic
993649595 5:90503406-90503428 GTTTAACTATGGCGGAATGATGG + Intronic
993829428 5:92736246-92736268 ACATTACTATAACAGAATGAAGG - Intergenic
994226573 5:97258466-97258488 ATATCATTTTAACAGAATGAAGG + Intergenic
994232466 5:97323788-97323810 ATTTCAATGTAGGAGAATAATGG - Intergenic
994402613 5:99300245-99300267 ACTTCACATTAACAGAATGAGGG + Intergenic
994908506 5:105871222-105871244 TTTTCAATATAGAATAATGATGG + Intergenic
996275071 5:121655683-121655705 AATATACTGTAGCAGAATGAGGG - Intergenic
997492936 5:134294227-134294249 AATTCACATTAACAGAATGAAGG + Intronic
1001016211 5:168143618-168143640 TTTGCCCTATAGCAGAAGGAGGG + Intronic
1001705722 5:173739992-173740014 AGATGACTAAAGCAGAATGAGGG + Intergenic
1003953115 6:11136996-11137018 ATGTCACTATTAAAGAATGATGG + Exonic
1004052156 6:12095343-12095365 ATTCCAATAGAGCAGAATAAAGG - Intronic
1005455230 6:26013647-26013669 ATTTCACTATTGATAAATGAAGG - Intergenic
1005687226 6:28266320-28266342 TTTTCACAATAGCAGAAACATGG - Intergenic
1006561852 6:34919935-34919957 ATTACAATATAGCATAATAAAGG - Intronic
1007893177 6:45315847-45315869 AATTCACAATAGCAAAATCATGG + Intronic
1009610866 6:65938634-65938656 ATTAAACTATAGTAGAAAGAAGG - Intergenic
1009839771 6:69054115-69054137 ATTCCACTATAGTGGAATAAAGG + Intronic
1010252766 6:73725280-73725302 TTTGCCCTATAGCAGAAGGAGGG + Intronic
1011231232 6:85164556-85164578 AATTATCTATAGCAGAATGAAGG - Intergenic
1011353944 6:86454266-86454288 ATTTCACAATATCACAATGAAGG - Intergenic
1011604374 6:89087911-89087933 ATTTAAATATAGGAGTATGATGG - Intergenic
1012097006 6:94975428-94975450 ATCTCAATACAGCAGAATTAAGG - Intergenic
1012410555 6:98951483-98951505 ACATCACTTTAACAGAATGAAGG - Intergenic
1014733687 6:125066404-125066426 ATTTGACTGTAGCAGGGTGAAGG - Intronic
1015376836 6:132519537-132519559 ATTTCACTAAAGAAGACAGATGG - Intergenic
1015498176 6:133902493-133902515 ATATCCATGTAGCAGAATGATGG - Intergenic
1015706518 6:136093964-136093986 ATTTGGCTATAGCAGTCTGAAGG - Intronic
1016195592 6:141334848-141334870 ATTTCTCCATAGCAAAAAGAAGG - Intergenic
1016910665 6:149195431-149195453 ATTTAATGAAAGCAGAATGAAGG + Intergenic
1017674910 6:156803326-156803348 TTTTCAGTATAGAAGAATAATGG + Intronic
1018900110 6:168047026-168047048 ATTTCACTTTAGGATAATCAAGG - Intergenic
1022995821 7:35754459-35754481 ATTTCACCATAGTAGACTGCTGG - Intergenic
1023159175 7:37280920-37280942 AATTCACAATAGCAAAATCATGG + Intronic
1024092348 7:45954311-45954333 ATTTCAGTATATCAGAAAAATGG - Intergenic
1026324415 7:69296376-69296398 ATTGCACTGTAGAGGAATGAGGG + Intergenic
1027396832 7:77765121-77765143 ATTTCACTTTAGAAAAATGCAGG + Intronic
1027721082 7:81742343-81742365 ATTTCACTATAGCAGAATGATGG - Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1030407192 7:109129358-109129380 CTTTAACAATAGCAGAGTGAAGG + Intergenic
1030936443 7:115590537-115590559 AATTCACAATAGCAAAATCATGG + Intergenic
1031834819 7:126669636-126669658 GTTTGACTATAGCATAATAAGGG - Intronic
1031903365 7:127434432-127434454 ATTTCTTTATAGCAGTGTGATGG - Intergenic
1032297687 7:130656359-130656381 ATTTACCAATATCAGAATGAAGG + Intronic
1032559124 7:132870048-132870070 ATTTCAATATAACAAAATAATGG + Intronic
1032882638 7:136105448-136105470 ATTTCACAATAGCAAAGTCAAGG - Intergenic
1033068616 7:138180617-138180639 ATTTCACTATAGGATGATCAGGG - Intergenic
1035003685 7:155638782-155638804 ATTTCATTACAGCAGCCTGAAGG - Intronic
1043575933 8:81656351-81656373 ATATCACTATTGTAGAAGGATGG + Intergenic
1045883345 8:107066272-107066294 TTTTCACAATAGCAGAAACATGG + Intergenic
1046953187 8:120037646-120037668 ATGTCACTCTAGCAGAAGAATGG + Intronic
1049946421 9:600993-601015 AATTAACTAAAGCAGAAGGAGGG + Intronic
1050720948 9:8588810-8588832 ATTTCTCTGAAGAAGAATGAGGG - Intronic
1051954233 9:22670670-22670692 AATTCAATATAGTAGAAAGAGGG - Intergenic
1052267252 9:26589299-26589321 ATATCACATTAACAGAATGAAGG - Intergenic
1054924210 9:70572968-70572990 ATTTCACTTCTGAAGAATGAAGG - Intronic
1054935693 9:70685341-70685363 GTTTCACTATATCAAAATCATGG + Intronic
1055251630 9:74314698-74314720 ATTTCATTTTAGCAAAATGAAGG + Intergenic
1055455599 9:76468669-76468691 ATCTCTCTTTAGCAGAAAGATGG + Intronic
1057982583 9:99675935-99675957 ATATTACAATAACAGAATGAAGG + Intergenic
1059695303 9:116724843-116724865 ATTTCAGTATAGTTGAAAGAGGG + Intronic
1059971308 9:119671556-119671578 AATTCCCTCTATCAGAATGAAGG + Intergenic
1061572931 9:131488788-131488810 ATGGCACCATAGCAGAGTGAAGG - Intronic
1061971629 9:134048447-134048469 ATTTCACTGTCGCAGAAAAAGGG - Exonic
1185890586 X:3818254-3818276 AATTCACAATAGCAAAATCATGG - Intronic
1185933257 X:4227028-4227050 AATTCACAATAGCAAAATCATGG + Intergenic
1186098173 X:6125956-6125978 ATTCCACTATAATAGAATAATGG + Intronic
1187711678 X:22060701-22060723 ATTTCACTTTAGAAGATTGTGGG + Intronic
1188778776 X:34253957-34253979 ATTTCACAATAGCACACTTATGG - Intergenic
1189648660 X:43164090-43164112 ATTTCACTAGTGGGGAATGAGGG - Intergenic
1189665008 X:43344783-43344805 TATTCACTATAGCAAAATCATGG - Intergenic
1190918548 X:54827765-54827787 AGTTCACTGTAGCAGATTGCAGG + Intergenic
1194057013 X:89147988-89148010 TTTTCACTATAGCAAAAATATGG + Intergenic
1194066943 X:89272377-89272399 ATATCACATTAACAGAATGAAGG - Intergenic
1194107436 X:89788665-89788687 ATTTCACTATAACGTTATGATGG - Intergenic
1194325549 X:92511757-92511779 AATTCAGTATAGCAGAAAAAAGG + Intronic
1195976910 X:110536642-110536664 ATGTCGCTAAAGGAGAATGACGG + Intergenic
1196578409 X:117349674-117349696 ATTTCAAAATAGCATAGTGAAGG - Intergenic
1197062505 X:122197991-122198013 ATATCACTTTAACAGAATGAAGG + Intergenic
1197435045 X:126417184-126417206 ATATCACATTAACAGAATGAGGG - Intergenic
1197574006 X:128185249-128185271 ATATCACATTAACAGAATGAAGG - Intergenic
1198424476 X:136502351-136502373 ATTTCTCATTTGCAGAATGAAGG - Intronic
1198538856 X:137614866-137614888 ATTTGACTATAGGAGAATGCTGG - Intergenic
1199313270 X:146346448-146346470 ATTTAAATAAATCAGAATGATGG - Intergenic
1200459395 Y:3436472-3436494 ATTTCACTATAACGTTATGATGG - Intergenic
1200634279 Y:5630923-5630945 AATTCAGTATAGCAGAAAAAAGG + Intronic
1200721105 Y:6606539-6606561 ATATCACATTAACAGAATGAAGG - Intergenic
1200892284 Y:8336764-8336786 ATTTCACTATTCCAGATGGATGG + Intergenic
1201481947 Y:14449296-14449318 ATTTCACTGTAGAAGAAGGCAGG + Intergenic
1201601402 Y:15732192-15732214 ATTTCACTAAAACAGGATGTGGG + Intergenic
1201682162 Y:16658727-16658749 GATTCACAATAGTAGAATGAAGG + Intergenic
1201894681 Y:18980997-18981019 AATTCACAATAGCAAAATCATGG + Intergenic