ID: 1027729097

View in Genome Browser
Species Human (GRCh38)
Location 7:81846854-81846876
Sequence TTGTGCAAATGTAATAACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027729097_1027729100 13 Left 1027729097 7:81846854-81846876 CCTGCGTTATTACATTTGCACAA No data
Right 1027729100 7:81846890-81846912 CTACTGCATGTTCAAGTAGTAGG No data
1027729097_1027729101 25 Left 1027729097 7:81846854-81846876 CCTGCGTTATTACATTTGCACAA No data
Right 1027729101 7:81846902-81846924 CAAGTAGTAGGTACAGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027729097 Original CRISPR TTGTGCAAATGTAATAACGC AGG (reversed) Intergenic
No off target data available for this crispr