ID: 1027729100

View in Genome Browser
Species Human (GRCh38)
Location 7:81846890-81846912
Sequence CTACTGCATGTTCAAGTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027729097_1027729100 13 Left 1027729097 7:81846854-81846876 CCTGCGTTATTACATTTGCACAA No data
Right 1027729100 7:81846890-81846912 CTACTGCATGTTCAAGTAGTAGG No data
1027729096_1027729100 18 Left 1027729096 7:81846849-81846871 CCATGCCTGCGTTATTACATTTG No data
Right 1027729100 7:81846890-81846912 CTACTGCATGTTCAAGTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027729100 Original CRISPR CTACTGCATGTTCAAGTAGT AGG Intergenic
No off target data available for this crispr