ID: 1027730518 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:81866197-81866219 |
Sequence | GCCTCTACTTTCTTTAGGTC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 133 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 5, 4: 126} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1027730518_1027730521 | -2 | Left | 1027730518 | 7:81866197-81866219 | CCAGACCTAAAGAAAGTAGAGGC | 0: 1 1: 0 2: 1 3: 5 4: 126 |
||
Right | 1027730521 | 7:81866218-81866240 | GCCAGAAACATTAAGAAGGTTGG | No data | ||||
1027730518_1027730520 | -6 | Left | 1027730518 | 7:81866197-81866219 | CCAGACCTAAAGAAAGTAGAGGC | 0: 1 1: 0 2: 1 3: 5 4: 126 |
||
Right | 1027730520 | 7:81866214-81866236 | AGAGGCCAGAAACATTAAGAAGG | No data | ||||
1027730518_1027730523 | 19 | Left | 1027730518 | 7:81866197-81866219 | CCAGACCTAAAGAAAGTAGAGGC | 0: 1 1: 0 2: 1 3: 5 4: 126 |
||
Right | 1027730523 | 7:81866239-81866261 | GGAGCAACTCAGAGTGAGTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1027730518 | Original CRISPR | GCCTCTACTTTCTTTAGGTC TGG (reversed) | Intergenic | ||