ID: 1027730518

View in Genome Browser
Species Human (GRCh38)
Location 7:81866197-81866219
Sequence GCCTCTACTTTCTTTAGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027730518_1027730521 -2 Left 1027730518 7:81866197-81866219 CCAGACCTAAAGAAAGTAGAGGC 0: 1
1: 0
2: 1
3: 5
4: 126
Right 1027730521 7:81866218-81866240 GCCAGAAACATTAAGAAGGTTGG No data
1027730518_1027730520 -6 Left 1027730518 7:81866197-81866219 CCAGACCTAAAGAAAGTAGAGGC 0: 1
1: 0
2: 1
3: 5
4: 126
Right 1027730520 7:81866214-81866236 AGAGGCCAGAAACATTAAGAAGG No data
1027730518_1027730523 19 Left 1027730518 7:81866197-81866219 CCAGACCTAAAGAAAGTAGAGGC 0: 1
1: 0
2: 1
3: 5
4: 126
Right 1027730523 7:81866239-81866261 GGAGCAACTCAGAGTGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027730518 Original CRISPR GCCTCTACTTTCTTTAGGTC TGG (reversed) Intergenic