ID: 1027730519

View in Genome Browser
Species Human (GRCh38)
Location 7:81866202-81866224
Sequence TTCTGGCCTCTACTTTCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027730519_1027730523 14 Left 1027730519 7:81866202-81866224 CCTAAAGAAAGTAGAGGCCAGAA No data
Right 1027730523 7:81866239-81866261 GGAGCAACTCAGAGTGAGTTTGG No data
1027730519_1027730521 -7 Left 1027730519 7:81866202-81866224 CCTAAAGAAAGTAGAGGCCAGAA No data
Right 1027730521 7:81866218-81866240 GCCAGAAACATTAAGAAGGTTGG No data
1027730519_1027730524 28 Left 1027730519 7:81866202-81866224 CCTAAAGAAAGTAGAGGCCAGAA No data
Right 1027730524 7:81866253-81866275 TGAGTTTGGCCATCAAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027730519 Original CRISPR TTCTGGCCTCTACTTTCTTT AGG (reversed) Intergenic