ID: 1027730521

View in Genome Browser
Species Human (GRCh38)
Location 7:81866218-81866240
Sequence GCCAGAAACATTAAGAAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027730519_1027730521 -7 Left 1027730519 7:81866202-81866224 CCTAAAGAAAGTAGAGGCCAGAA No data
Right 1027730521 7:81866218-81866240 GCCAGAAACATTAAGAAGGTTGG No data
1027730518_1027730521 -2 Left 1027730518 7:81866197-81866219 CCAGACCTAAAGAAAGTAGAGGC 0: 1
1: 0
2: 1
3: 5
4: 126
Right 1027730521 7:81866218-81866240 GCCAGAAACATTAAGAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027730521 Original CRISPR GCCAGAAACATTAAGAAGGT TGG Intergenic