ID: 1027730522 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:81866219-81866241 |
Sequence | TCCAACCTTCTTAATGTTTC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1027730522_1027730523 | -3 | Left | 1027730522 | 7:81866219-81866241 | CCAGAAACATTAAGAAGGTTGGA | No data | ||
Right | 1027730523 | 7:81866239-81866261 | GGAGCAACTCAGAGTGAGTTTGG | No data | ||||
1027730522_1027730524 | 11 | Left | 1027730522 | 7:81866219-81866241 | CCAGAAACATTAAGAAGGTTGGA | No data | ||
Right | 1027730524 | 7:81866253-81866275 | TGAGTTTGGCCATCAAACTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1027730522 | Original CRISPR | TCCAACCTTCTTAATGTTTC TGG (reversed) | Intergenic | ||