ID: 1027730522

View in Genome Browser
Species Human (GRCh38)
Location 7:81866219-81866241
Sequence TCCAACCTTCTTAATGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027730522_1027730523 -3 Left 1027730522 7:81866219-81866241 CCAGAAACATTAAGAAGGTTGGA No data
Right 1027730523 7:81866239-81866261 GGAGCAACTCAGAGTGAGTTTGG No data
1027730522_1027730524 11 Left 1027730522 7:81866219-81866241 CCAGAAACATTAAGAAGGTTGGA No data
Right 1027730524 7:81866253-81866275 TGAGTTTGGCCATCAAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027730522 Original CRISPR TCCAACCTTCTTAATGTTTC TGG (reversed) Intergenic