ID: 1027731891

View in Genome Browser
Species Human (GRCh38)
Location 7:81884988-81885010
Sequence AAAAGACTGCACATGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027731891_1027731901 17 Left 1027731891 7:81884988-81885010 CCAGCCACCATGTGCAGTCTTTT No data
Right 1027731901 7:81885028-81885050 CAGGAAATTACTACCTGTGTGGG No data
1027731891_1027731894 -8 Left 1027731891 7:81884988-81885010 CCAGCCACCATGTGCAGTCTTTT No data
Right 1027731894 7:81885003-81885025 AGTCTTTTGCTTTCAGCCCGCGG No data
1027731891_1027731900 16 Left 1027731891 7:81884988-81885010 CCAGCCACCATGTGCAGTCTTTT No data
Right 1027731900 7:81885027-81885049 CCAGGAAATTACTACCTGTGTGG No data
1027731891_1027731895 -2 Left 1027731891 7:81884988-81885010 CCAGCCACCATGTGCAGTCTTTT No data
Right 1027731895 7:81885009-81885031 TTGCTTTCAGCCCGCGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027731891 Original CRISPR AAAAGACTGCACATGGTGGC TGG (reversed) Intergenic
No off target data available for this crispr