ID: 1027731892

View in Genome Browser
Species Human (GRCh38)
Location 7:81884992-81885014
Sequence AAGCAAAAGACTGCACATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027731892_1027731895 -6 Left 1027731892 7:81884992-81885014 CCACCATGTGCAGTCTTTTGCTT No data
Right 1027731895 7:81885009-81885031 TTGCTTTCAGCCCGCGGCCCAGG No data
1027731892_1027731900 12 Left 1027731892 7:81884992-81885014 CCACCATGTGCAGTCTTTTGCTT No data
Right 1027731900 7:81885027-81885049 CCAGGAAATTACTACCTGTGTGG No data
1027731892_1027731901 13 Left 1027731892 7:81884992-81885014 CCACCATGTGCAGTCTTTTGCTT No data
Right 1027731901 7:81885028-81885050 CAGGAAATTACTACCTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027731892 Original CRISPR AAGCAAAAGACTGCACATGG TGG (reversed) Intergenic
No off target data available for this crispr