ID: 1027731901

View in Genome Browser
Species Human (GRCh38)
Location 7:81885028-81885050
Sequence CAGGAAATTACTACCTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027731893_1027731901 10 Left 1027731893 7:81884995-81885017 CCATGTGCAGTCTTTTGCTTTCA No data
Right 1027731901 7:81885028-81885050 CAGGAAATTACTACCTGTGTGGG No data
1027731890_1027731901 18 Left 1027731890 7:81884987-81885009 CCCAGCCACCATGTGCAGTCTTT No data
Right 1027731901 7:81885028-81885050 CAGGAAATTACTACCTGTGTGGG No data
1027731891_1027731901 17 Left 1027731891 7:81884988-81885010 CCAGCCACCATGTGCAGTCTTTT No data
Right 1027731901 7:81885028-81885050 CAGGAAATTACTACCTGTGTGGG No data
1027731892_1027731901 13 Left 1027731892 7:81884992-81885014 CCACCATGTGCAGTCTTTTGCTT No data
Right 1027731901 7:81885028-81885050 CAGGAAATTACTACCTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027731901 Original CRISPR CAGGAAATTACTACCTGTGT GGG Intergenic
No off target data available for this crispr