ID: 1027737177

View in Genome Browser
Species Human (GRCh38)
Location 7:81947692-81947714
Sequence TGGAAATCAATATTAATAAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 324}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027737177 Original CRISPR TGGAAATCAATATTAATAAC AGG Exonic
903059538 1:20660520-20660542 TAGCAATCCATATTAATAACAGG + Intronic
906286886 1:44593423-44593445 AAGATATCAATAATAATAACAGG + Intronic
907843174 1:58176376-58176398 TGTAAAACATTATTAAAAACTGG + Intronic
909903752 1:81171255-81171277 TGAAACTCAAAATCAATAACAGG - Intergenic
911231525 1:95366852-95366874 TAGCAATCATTATTAATATCTGG + Intergenic
912913010 1:113781727-113781749 AGAAAATGAATATTATTAACCGG - Intronic
913966359 1:143380720-143380742 TGTATATTAATATTAATCACAGG - Intergenic
914060732 1:144206327-144206349 TGTATATTAATATTAATCACAGG - Intergenic
914118418 1:144760042-144760064 TGTATATTAATATTAATCACAGG + Intergenic
914701938 1:150142564-150142586 TGCAAAACAATGGTAATAACTGG + Intronic
915182073 1:154070651-154070673 TGTAACTAAATATTAAGAACTGG - Intronic
916359350 1:163950971-163950993 TATAAAGCAATATTTATAACTGG - Intergenic
916683968 1:167127923-167127945 TGGATAGCAGTATTAATAAGTGG + Exonic
916971410 1:170021738-170021760 TAGAAATACAAATTAATAACGGG - Intronic
917221834 1:172739761-172739783 TGAAAATAGAAATTAATAACAGG - Intergenic
917544918 1:175954897-175954919 TGAAAACCAATTTTAATATCTGG - Intronic
918303392 1:183224276-183224298 TGGCAAGCAATATTTATAGCTGG + Intronic
919184618 1:194129916-194129938 TGGTAATAAATATAATTAACTGG - Intergenic
919968165 1:202550167-202550189 AGGAAATAAATATTAATACTTGG - Intronic
921304913 1:213786360-213786382 TGGAAATATATATTAACAATGGG - Intergenic
921605218 1:217144304-217144326 TGGAAATGAGTATGAATAAATGG - Intergenic
921854475 1:219966867-219966889 TTGAAATCAATTTCACTAACAGG + Intergenic
922120427 1:222661949-222661971 TGGAAAGCAACATTAAAAATGGG - Intronic
922855373 1:228770545-228770567 TGGAAAACAATAATAAAAAGAGG + Intergenic
923514055 1:234679821-234679843 TGAAAATTAATATTTTTAACAGG + Intergenic
924220798 1:241873439-241873461 TGTAAAGCAAAATTAATAATAGG - Intronic
1062897487 10:1115550-1115572 TGGAAATCGACATTTTTAACTGG + Intronic
1066170144 10:32834012-32834034 ATGAAATCAAAATTAATAAAGGG - Intronic
1067454616 10:46409601-46409623 TGGAAATGAGTATTAATCCCAGG + Intergenic
1067632587 10:47975038-47975060 TGGAAATGAGTATTAATCCCAGG - Intergenic
1068342305 10:55721185-55721207 TGGAAATAAATAATGATAAATGG + Intergenic
1068412189 10:56670608-56670630 TGGAAATCACTCTTTATACCCGG + Intergenic
1069237818 10:66100093-66100115 TGGAAATAGATATTAGTAAACGG + Intronic
1069245042 10:66193846-66193868 TTGAAATCAATAAGAATTACGGG + Intronic
1070471649 10:76786297-76786319 GGGAAATCAATTTTAATGAAAGG + Intergenic
1071010732 10:80937579-80937601 TGGACATGCATCTTAATAACTGG - Intergenic
1071034547 10:81228649-81228671 TCCAAATCAATATTAGTAATTGG + Intergenic
1071427091 10:85569617-85569639 TGTAAATAAATATTAAAAATTGG - Intergenic
1072544057 10:96420759-96420781 TGGGATTCAATCTTATTAACGGG + Intronic
1073583139 10:104685685-104685707 TGGAAATCACTATACAGAACGGG - Intronic
1073894754 10:108142585-108142607 TGGAAAACAAAACTAATAATAGG + Intergenic
1074653546 10:115555663-115555685 TTAAAATCTATATTATTAACTGG + Intronic
1075951799 10:126484888-126484910 TGAAAATAACTTTTAATAACAGG + Intronic
1075990107 10:126829402-126829424 TGAAATTCAAAATTAATAAAAGG + Intergenic
1077212225 11:1376558-1376580 TATAAATCAGTATTAAAAACCGG + Intergenic
1078351241 11:10595526-10595548 TGGAAAGCAATATAATTAAGAGG - Intronic
1078575659 11:12500212-12500234 TGGAAAGCAGTATTTAAAACAGG - Intronic
1079700011 11:23534334-23534356 TGGAGAAAAATATTAATAAATGG - Intergenic
1080006579 11:27414241-27414263 TGGAGAGAAGTATTAATAACAGG - Intronic
1080162064 11:29188863-29188885 TGGAAAATAATAATAATAAATGG + Intergenic
1080524022 11:33095519-33095541 GGGAAATAAATACTAAAAACCGG + Intronic
1081000915 11:37669718-37669740 TTGAAATAAATATTCCTAACTGG - Intergenic
1081232401 11:40601887-40601909 TCAAAATAAATATTAATAACTGG + Intronic
1081285844 11:41269272-41269294 AGGAAATAAATAATAATAAAAGG - Intronic
1081302673 11:41472033-41472055 TGCAAATTATTATTACTAACAGG + Intergenic
1082952964 11:58837703-58837725 TGGAAAGAAATATAAAGAACAGG + Intronic
1082955058 11:58861845-58861867 TGAAAATAGAAATTAATAACTGG - Intronic
1087069277 11:94060981-94061003 TGGAGATCAACATAAATAAATGG + Intronic
1087360613 11:97154487-97154509 GGGAATTCAATAGAAATAACTGG + Intergenic
1088047147 11:105467898-105467920 TTGAAAACAATAATAGTAACAGG - Intergenic
1088398793 11:109399923-109399945 TGGAAATCCATATTTTTAACAGG + Intergenic
1091052152 11:132382398-132382420 TGGAAATCAATAACAACACCGGG + Intergenic
1091179404 11:133589836-133589858 AGGAAATCAAGGTTAGTAACTGG + Intergenic
1091647936 12:2287850-2287872 TGGAAATCACGATTATGAACAGG + Intronic
1092354222 12:7781428-7781450 CATTAATCAATATTAATAACAGG + Intergenic
1092605704 12:10116186-10116208 TGGTAATCAAGGTAAATAACTGG - Intergenic
1093368869 12:18340767-18340789 TGGGAAACAATGTTAATAAAGGG + Intronic
1094159535 12:27375858-27375880 TGGTAACCAATATTGAAAACTGG - Intronic
1095460103 12:42434372-42434394 TGGAAATAAAAATAAATAAATGG + Intronic
1096428883 12:51526989-51527011 TAAACATCATTATTAATAACTGG + Intergenic
1097443121 12:59635310-59635332 AGGCAATCAATGTTAATAAGGGG - Intronic
1097515181 12:60595259-60595281 TGGTAAGTAATATTAATGACTGG - Intergenic
1097716632 12:62973010-62973032 TTGAAATCAAATTTTATAACGGG + Intergenic
1097941919 12:65318547-65318569 TGGAAAAAAAAATTAAAAACAGG + Intronic
1098637290 12:72800014-72800036 TTGAAATTAAGATTAAGAACAGG - Intergenic
1099064858 12:77963233-77963255 GGGAAATCCATATTAAAAACAGG + Intronic
1099952155 12:89315941-89315963 TGGAAATAAATATTCTTAAATGG - Intergenic
1103044427 12:117723947-117723969 TTGAAATAAATAGTAAGAACAGG - Intronic
1104179571 12:126365470-126365492 TGGACATGAATATTAATAGTTGG - Intergenic
1105976024 13:25473407-25473429 TGGAAATGAATAGTAATTAATGG + Intronic
1106170123 13:27281459-27281481 TGGACGTCAATATTGGTAACAGG + Intergenic
1107313441 13:39105134-39105156 AGGAAATAAATATTCTTAACAGG - Intergenic
1109108291 13:58283186-58283208 TATAAATAAATATTAATAAATGG + Intergenic
1109509977 13:63358711-63358733 TGGCATTCAATATGAGTAACAGG + Intergenic
1109973777 13:69804563-69804585 TTTAATGCAATATTAATAACTGG + Intronic
1110186615 13:72682726-72682748 AGGTAATCAATGTTAACAACAGG - Intergenic
1110342351 13:74407121-74407143 TGGGAATCAAGATTCAGAACTGG + Intergenic
1110879845 13:80558326-80558348 TGTAAATCAATGTTAGAAACAGG - Intergenic
1111244101 13:85512221-85512243 TGATAATCTATTTTAATAACTGG + Intergenic
1111296730 13:86289140-86289162 TAGAAATCAAAATTAAAAAGAGG - Intergenic
1111608632 13:90575385-90575407 TGGAAATGAATTATAATAAAAGG - Intergenic
1111720839 13:91942409-91942431 TGGAAATCTATACTATGAACAGG + Intronic
1112049880 13:95634891-95634913 TTGGAATAATTATTAATAACTGG + Intronic
1113232370 13:108227013-108227035 TGGAAGTCATTTTTAAGAACAGG - Intronic
1114362856 14:21994664-21994686 TGAAATTCAATATAAATACCAGG - Intergenic
1115563447 14:34603668-34603690 TAGATATAAATATTATTAACTGG - Intronic
1117989223 14:61417171-61417193 TGGAAATAATGATTAATAAAGGG - Intronic
1120411711 14:84165465-84165487 TGGAAATTCATATTGATAAATGG + Intergenic
1120847114 14:89136164-89136186 TGGAAAACAATTATAATAACTGG - Intronic
1124114158 15:26824596-26824618 TGGAAAGTAATATTACAAACTGG + Intronic
1127615448 15:60680627-60680649 TAATAATCAATATAAATAACTGG + Intronic
1129019421 15:72502953-72502975 TAGAAGTAAATATTCATAACTGG + Intronic
1133120905 16:3606875-3606897 TAGACATAAATATCAATAACAGG + Intronic
1138054507 16:53818324-53818346 TGAAAACAAATAATAATAACTGG - Intronic
1138359346 16:56414097-56414119 TGGAACAAAATATTAACAACTGG + Intronic
1138614601 16:58155096-58155118 TGAAAGTAAATATTAATAAGTGG - Intergenic
1140661187 16:77192452-77192474 TGGAAATCAATGGGAATAAATGG + Intronic
1140702254 16:77591860-77591882 TGCAAATAAATATTAATGACCGG + Intergenic
1141059289 16:80850639-80850661 AGGAAATTATTATTAATAAATGG - Intergenic
1141399128 16:83731926-83731948 TGAAAAGCAATATTCACAACTGG - Intronic
1141473251 16:84253727-84253749 TCAAAATCTATATTAATAACAGG + Intergenic
1141497276 16:84418904-84418926 TGGAAATCAACAGTGCTAACAGG + Intronic
1144161417 17:12564067-12564089 AGGAAATCATTATTATCAACAGG + Intergenic
1144522465 17:15962818-15962840 TGGGCATCAAAATAAATAACAGG - Intronic
1144593526 17:16545686-16545708 ATGAAATCAAAATTATTAACAGG + Intergenic
1144634748 17:16897940-16897962 TTCAAATCAATATTAAAAAAAGG - Intergenic
1147574436 17:41590526-41590548 TGCAAAGCAATAGTAAAAACTGG + Intergenic
1149089133 17:52757169-52757191 TTTAAATAGATATTAATAACAGG - Intergenic
1149413622 17:56435067-56435089 TTGAAATGGAGATTAATAACTGG - Intronic
1203172036 17_GL000205v2_random:157382-157404 TGGAGATCAAGAATGATAACAGG + Intergenic
1153067651 18:1064493-1064515 TGGAAATCTATATTAAGGATTGG - Intergenic
1155418225 18:25625078-25625100 TGCAAATCACTTTTAATATCAGG - Intergenic
1155673899 18:28406340-28406362 TGGAAGGAAATATTAACAACCGG + Intergenic
1155827247 18:30462494-30462516 TGGAAAACAATATTTTTAAAAGG - Intergenic
1155926126 18:31657494-31657516 TAGAAAACAATTTTCATAACCGG + Intronic
1156567272 18:38206628-38206650 TGTAAATCAATAATAAAAAAGGG + Intergenic
1156591174 18:38490189-38490211 TGGAAGAAAATATTAATGACAGG - Intergenic
1156815624 18:41307633-41307655 TGGATAACAATATTATTAAGAGG + Intergenic
1158178899 18:54689526-54689548 AGGAAATCAAGATTAGGAACAGG - Intergenic
1164862716 19:31575280-31575302 TGAAAATCAATACTCAGAACAGG + Intergenic
1166658775 19:44631285-44631307 TGAAAATAAAAATTAAAAACAGG + Intronic
1202700140 1_KI270712v1_random:158215-158237 TGTATATTAATATTAATCACAGG - Intergenic
925592471 2:5524068-5524090 AGTTAATCAATATAAATAACTGG + Intergenic
926403999 2:12530623-12530645 TAGAAAAAAATATTAATAAAAGG - Intergenic
927307790 2:21593567-21593589 TGGAGATCACTATTATTACCAGG - Intergenic
927614132 2:24572809-24572831 TGCCACTCAATAATAATAACTGG - Intronic
928066250 2:28167366-28167388 TCTAAATCTTTATTAATAACGGG + Intronic
929217113 2:39426096-39426118 TCAAAATCAACATTAATAAGGGG + Intronic
929652026 2:43689575-43689597 TGGTAATTAATATGAATAAGAGG - Intronic
930356656 2:50329206-50329228 TGCAAATCAATGTGAATAAAAGG + Intronic
931025710 2:58111682-58111704 TGGAACTCAAGATTTATACCAGG - Intronic
933370321 2:81407240-81407262 TGGTAATCAAAATTTATACCTGG - Intergenic
933436658 2:82257816-82257838 TTGAATTAAATTTTAATAACAGG - Intergenic
934171073 2:89541690-89541712 TGTATATTAATATTAATCACAGG - Intergenic
934281378 2:91616008-91616030 TGTATATTAATATTAATCACAGG - Intergenic
935405665 2:102706608-102706630 TGCAAATCTAAAATAATAACTGG + Intronic
938851487 2:135265370-135265392 TGGAAAACAATATTAATTTTTGG + Intronic
940624871 2:156161446-156161468 TGGATATCAAAAATAATAACTGG + Intergenic
941343799 2:164341689-164341711 TGGAAATCCATAATAATAGTAGG - Intergenic
941642448 2:168003414-168003436 TGGACATTAATATTAAAAGCTGG - Intronic
942089648 2:172477322-172477344 TGGAAATCACCATTAAAAATTGG + Intronic
942323878 2:174759243-174759265 AGGAAATCAATATGGGTAACAGG - Intronic
943852444 2:192741782-192741804 TGGACATCAATATGAATGAATGG - Intergenic
945501269 2:210578408-210578430 TGGAAATTAATATTTATGGCTGG - Intronic
948288649 2:236807808-236807830 TGGAAAACAATTTAAAAAACAGG + Intergenic
948708185 2:239808543-239808565 TGAAAATCAAATTTAAAAACTGG - Intergenic
1169757019 20:9053340-9053362 TGGAGATCATTATCAATGACAGG - Intergenic
1169871452 20:10253042-10253064 TGGAAATGATAATTAAGAACAGG - Intronic
1170011728 20:11730730-11730752 TGGAAATAAATTTCAATAATTGG + Intergenic
1170550524 20:17472267-17472289 TGGAAATAAATGTTAAAACCTGG + Intronic
1170861698 20:20110485-20110507 TAAAAATCAAGATTAATATCTGG + Intronic
1170967849 20:21092029-21092051 GACAAATCACTATTAATAACTGG + Intergenic
1171570084 20:26241013-26241035 AAAAAATCAATGTTAATAACTGG - Intergenic
1172016552 20:31878660-31878682 TGGAAATCAGAATTAAAAAATGG - Intronic
1172733154 20:37105625-37105647 TGGCAAACAATATGAATAAGAGG - Intronic
1174526000 20:51172011-51172033 TGGATATCAGTATTCAGAACTGG - Intergenic
1174544195 20:51313177-51313199 GGGAAATCTATAGTAAAAACAGG + Intergenic
1176328019 21:5519219-5519241 TGGAGATCAAGAATGATAACAGG + Intergenic
1176399738 21:6301732-6301754 TGGAGATCAAGAATGATAACAGG - Intergenic
1176437419 21:6687372-6687394 TGGAGATCAAGAATGATAACAGG + Intergenic
1176461681 21:7014442-7014464 TGGAGATCAAGAATGATAACAGG + Intergenic
1176485242 21:7396220-7396242 TGGAGATCAAGAATGATAACAGG + Intergenic
1177182821 21:17761736-17761758 GGGAAATAAAAATAAATAACTGG + Intergenic
1177430360 21:20984796-20984818 TACAAATAAATAATAATAACCGG - Intergenic
1178354141 21:31896494-31896516 AGGAAATCAATAATATTCACTGG + Intronic
1178448915 21:32673573-32673595 TGAAAATCAATTTTTATAAATGG - Intronic
1178553008 21:33557735-33557757 TGGAAATTAATAAGAATAGCTGG + Intronic
1179064624 21:38013240-38013262 TGCATATCCAGATTAATAACAGG + Intronic
1182914588 22:34017572-34017594 TGGAAATCAATCAGAATAATTGG - Intergenic
1183683385 22:39348193-39348215 TCGAACTCAATAATAATAAGAGG - Intergenic
950347375 3:12309467-12309489 TTAAAATCAATATTGATAAGTGG + Intronic
952085021 3:29810281-29810303 TAGAAATAAAAATTTATAACTGG - Intronic
953104103 3:39858711-39858733 TGAAACTAAAAATTAATAACAGG + Intronic
953922563 3:46962549-46962571 TAGAAATCAATAGGAAAAACAGG + Intronic
955346581 3:58166117-58166139 TGTAAAACAGGATTAATAACAGG + Intronic
955438076 3:58925378-58925400 TGTAAATAATTATTGATAACGGG - Intronic
956052151 3:65259919-65259941 TGAAAATAAAAATTGATAACTGG + Intergenic
956329371 3:68088634-68088656 ATGGAATCAATATTCATAACAGG - Intronic
957109384 3:75933195-75933217 AAAAAATCAATGTTAATAACTGG + Intronic
957738907 3:84237224-84237246 TTGAGATAAATATTAATAAAAGG + Intergenic
957872382 3:86106177-86106199 TGAAAAGCATTATCAATAACTGG + Intergenic
957905495 3:86548443-86548465 TGAAAAACAATTTTAATAAAGGG + Intergenic
958036736 3:88178672-88178694 TGGAAATACATATTAAAACCAGG + Intergenic
958170299 3:89931327-89931349 TGGTAATAAATAAAAATAACAGG + Intergenic
958744607 3:98117147-98117169 AGGAAATCAATATGAATCAATGG - Intergenic
959010638 3:101071438-101071460 TGGAACTCAATAATACTAATAGG + Intergenic
960287919 3:115850586-115850608 TAGAAAATAATAGTAATAACTGG + Intronic
960924656 3:122782308-122782330 TGGCAATCAATATTAATCCTTGG + Intronic
962487740 3:135861485-135861507 GGGAAATTAAGATTAATAAATGG + Intergenic
963081690 3:141401111-141401133 TGGAATCCACTATTAACAACAGG + Intronic
963370663 3:144395672-144395694 GGGATAAAAATATTAATAACTGG - Intergenic
964249095 3:154689686-154689708 TTGAAATCAATGTTGATCACTGG - Intergenic
964861153 3:161202916-161202938 TGGAAATCAATAAACATTACTGG + Intronic
965562614 3:170076079-170076101 TGGAAATATATACAAATAACTGG + Intronic
967260525 3:187637328-187637350 GGAAAATAGATATTAATAACTGG + Intergenic
969028697 4:4194197-4194219 TGTATATTAATATTAATCACAGG + Intronic
969911529 4:10451534-10451556 TGGAAAATAATATTTTTAACAGG - Intronic
971678117 4:29661208-29661230 TTGAAATAAATATTAAGAGCAGG + Intergenic
972318869 4:37953910-37953932 TGATAATCTACATTAATAACGGG - Intronic
972322372 4:37983688-37983710 TGGTGAGGAATATTAATAACAGG - Intronic
973788113 4:54353395-54353417 TGGAAATACATATTAATAAAAGG + Intergenic
973857506 4:55028017-55028039 TGTAAAGCAATATTAAAACCAGG - Intergenic
974498548 4:62666163-62666185 TCAAACTCAATATTAATAAAGGG + Intergenic
974574002 4:63692950-63692972 AGGAAATGAATATTGATAAATGG + Intergenic
975283543 4:72591390-72591412 TGGAAATTAACATTGAAAACTGG + Intergenic
975989158 4:80239034-80239056 TGGCAATCAATATTAACAAATGG + Intergenic
976130325 4:81877335-81877357 TGGAAATCATCATTAGTAAATGG - Intronic
976783768 4:88792458-88792480 TGGGAACCACTATGAATAACAGG - Intronic
977421150 4:96801491-96801513 TGAAAAGCAATATGAATAGCAGG - Intergenic
977872545 4:102109573-102109595 TGGAAATCAATAATAAGAGAAGG + Intergenic
978114556 4:105003728-105003750 TGGAAGTCATTGATAATAACAGG + Intergenic
981093285 4:140755570-140755592 TGGAAAACAATATTTTTAAGGGG + Intronic
981401931 4:144323049-144323071 TGGAAATGAATATTTACTACAGG + Intergenic
982273172 4:153612492-153612514 TTTGAATCCATATTAATAACTGG + Intronic
983366047 4:166790830-166790852 TGGATATGAATTTTAAAAACAGG + Intronic
983846684 4:172529112-172529134 TGGATATTAATGTAAATAACTGG + Intronic
984479465 4:180280340-180280362 TTGAAACCAATATCAAAAACAGG - Intergenic
986071903 5:4293717-4293739 TGGAAATCAATAGAACCAACTGG + Intergenic
986119696 5:4821592-4821614 TGGGAATAAAAATAAATAACAGG - Intergenic
986147991 5:5098287-5098309 TGGAAAACAATATTAATAAGTGG + Intergenic
986222968 5:5787081-5787103 TGGTAACCAATGTTAAAAACAGG - Intergenic
987190625 5:15473718-15473740 TAGAATTCAAAATTAATACCAGG - Intergenic
987457740 5:18167467-18167489 TGCAAATCTATCTTAATAAAGGG - Intergenic
987515026 5:18894712-18894734 TGAAAATCTGTAATAATAACAGG + Intergenic
987525696 5:19046587-19046609 TAGTATACAATATTAATAACAGG + Intergenic
987939634 5:24516453-24516475 TGAAAATCACTATTAGTAAATGG - Intronic
988175990 5:27725479-27725501 TAGAAATGTATATTATTAACAGG - Intergenic
988181444 5:27799564-27799586 TGAAGATCAATATTAATAGGGGG + Intergenic
988499621 5:31773737-31773759 TGAAATTCAGTATTAATACCTGG + Intronic
988849810 5:35169475-35169497 TGTAAATTAATATTGAAAACAGG + Intronic
989164397 5:38420624-38420646 TGAATAACAATATTAATAACAGG - Intronic
989422841 5:41260057-41260079 TAGAAATCATTATCCATAACTGG - Intronic
989708680 5:44370151-44370173 TGGAAATAGGTAGTAATAACAGG - Intronic
991251713 5:64569560-64569582 TTGAAACCAAAATTAATAACTGG + Intronic
993130096 5:83885902-83885924 TGGAAATAAAAATTAAAAATAGG - Intergenic
993477031 5:88378879-88378901 TAAAAATAAATATAAATAACAGG - Intergenic
993604920 5:89977604-89977626 TGAAAATGAAGAATAATAACAGG + Intergenic
994057795 5:95438843-95438865 TTGTAATCAATATTAACACCAGG + Intronic
994655551 5:102588743-102588765 TGGCAATTAAAATTAAGAACTGG + Intergenic
995218358 5:109620659-109620681 GGGAAATAACTATTAAAAACAGG - Intergenic
995594487 5:113733336-113733358 TGTAAATAAATAGTAATATCTGG - Intergenic
996691576 5:126346025-126346047 TGGAAATCAATATCTAAAGCAGG + Intergenic
997752759 5:136364298-136364320 TGGAAATAAATATTTATGAAAGG + Intronic
997821094 5:137066695-137066717 TAGAAATCAAGAATAATAACTGG + Intronic
998715320 5:144877041-144877063 TAGAAAAAAATATTAGTAACAGG - Intergenic
999798927 5:155014877-155014899 TGGGGATCAATATTAACAATAGG - Exonic
1003191275 6:3877316-3877338 TTGAAAACAATATTAACAATTGG - Intergenic
1003583521 6:7364440-7364462 GGGAAGTCAATAATAATTACTGG + Intronic
1004832166 6:19488730-19488752 TGGAAAAAAGTATTCATAACTGG - Intergenic
1005310981 6:24558802-24558824 TGGAAAACAATAATAATTATGGG - Intronic
1009300011 6:62005966-62005988 TTGAAAGCAATATTAAGAAATGG + Intronic
1009505630 6:64474582-64474604 TGGCCATCAATATTAATAGCAGG - Intronic
1009816274 6:68739972-68739994 TGAAAAACAACATTAATAACAGG + Intronic
1010546826 6:77169027-77169049 AGGAAATAAATATTAAAATCAGG - Intergenic
1010855998 6:80840449-80840471 TGTAAATCAATATGAAAAATAGG - Intergenic
1012315217 6:97776466-97776488 TACAAATTAATAATAATAACTGG - Intergenic
1012340677 6:98118995-98119017 TAGAAATCATTATTCATAATAGG + Intergenic
1012354744 6:98299933-98299955 TGCTAATAAATATTAATAAATGG + Intergenic
1012448365 6:99329402-99329424 TAGAAATGAATATTTATAAGTGG + Intronic
1012749730 6:103142657-103142679 TGGAAATCAATACTTATAATAGG - Intergenic
1014177868 6:118349828-118349850 TGGAAATTAAAATAAAAAACTGG + Intergenic
1014398307 6:120953929-120953951 TGGAAATCAATGTTGATGGCAGG - Intergenic
1014798762 6:125754686-125754708 TGGAAATCAATGCTAATGGCAGG + Intronic
1016855390 6:148665152-148665174 TAGAAATCAAAATCAATAAGAGG - Intergenic
1017301541 6:152865805-152865827 CTGAATTCAATGTTAATAACCGG - Intergenic
1017531968 6:155302292-155302314 TTGAAATAAATATTTGTAACAGG + Intronic
1017714564 6:157200092-157200114 TGGGAAGCAAGCTTAATAACAGG + Intronic
1018106691 6:160494254-160494276 TGGTAAAAAATATTAATAAAAGG - Intergenic
1018954163 6:168396785-168396807 TGGAAATGAAAATTAATCGCAGG + Intergenic
1020353928 7:7256464-7256486 AGTAATTCAATATTAAAAACTGG - Intergenic
1021111071 7:16695205-16695227 TGGAAATCACTATTAATTTCTGG - Intronic
1021426094 7:20501391-20501413 TGGAAACCAAGTTTAATACCTGG - Intergenic
1021668297 7:23010680-23010702 TTGAAATAAATATTGATATCTGG + Intronic
1022138326 7:27469886-27469908 AGGAAATCAAGATTAAAACCTGG - Intergenic
1022188366 7:27992238-27992260 TGAAAACCAATATTTATAAGGGG - Intronic
1027608507 7:80330080-80330102 TGAAATTCAATATCAAGAACTGG + Intergenic
1027737177 7:81947692-81947714 TGGAAATCAATATTAATAACAGG + Exonic
1027825012 7:83101103-83101125 TGCTAATTAATTTTAATAACTGG - Intronic
1028345396 7:89774796-89774818 TAGAAGTCAATATTGTTAACAGG + Intergenic
1029336767 7:99907024-99907046 AGGAAATCAATTTTAAAAATGGG + Intronic
1030429644 7:109427973-109427995 TACAAATCAATAAGAATAACAGG + Intergenic
1032589855 7:133182012-133182034 TGGAAAAGAATGTTAAGAACTGG + Intergenic
1033798450 7:144874433-144874455 TGGAAATTAATATGAAAAATTGG + Intergenic
1033923103 7:146419693-146419715 TGCAAATCAAAATTAAAAACAGG + Intronic
1034958232 7:155349280-155349302 TGGAAAATAATATTAGTAAGGGG + Intergenic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1035683735 8:1508080-1508102 TGGAAATAAAATTTAAAAACGGG - Intronic
1036438196 8:8755569-8755591 TAGAAATCAATATGAATCTCAGG - Intergenic
1038275842 8:26119971-26119993 TTAAAAACAGTATTAATAACAGG - Intergenic
1038806334 8:30795748-30795770 TGCAAGCCAATTTTAATAACTGG + Intronic
1038960863 8:32518067-32518089 TGGAAATAAATATTTATATTTGG - Intronic
1039018411 8:33178921-33178943 TGGAAACCAATAATGATAGCTGG + Intergenic
1042102246 8:65286097-65286119 TGGAAATCAATGCTTAAAACAGG + Intergenic
1042391251 8:68238092-68238114 AGGAAACCAAAATCAATAACTGG + Intergenic
1042705241 8:71659898-71659920 TGGAAAAAAATATCAATAATAGG + Intergenic
1043173465 8:76994955-76994977 TTGAAATCAATACTAATAAATGG + Intronic
1043296809 8:78673995-78674017 TGGAAATTAATGTCAAGAACTGG + Intronic
1044354499 8:91204974-91204996 TGGAAAAAAATATTAAAAATCGG - Intronic
1044752119 8:95426411-95426433 TTGAATTCAATCTTAAAAACTGG + Intergenic
1045786786 8:105931090-105931112 TGCAAATCAAGATAAATAAATGG + Intergenic
1046216240 8:111151670-111151692 TGGAAATGAACATTCATTACAGG - Intergenic
1046491892 8:114964448-114964470 TGGAAACCAAAATAAATATCAGG - Intergenic
1046588167 8:116173623-116173645 TAAAAATTAATATTAATAAATGG - Intergenic
1048649657 8:136461195-136461217 GATAAATCAATATTAATAATTGG + Intergenic
1050769792 9:9183563-9183585 TGGAAATCACTATTGTTCACAGG + Intronic
1051058993 9:13024456-13024478 TGCAACTCAATATTTTTAACAGG - Intergenic
1052097884 9:24406903-24406925 TAGAAATAATTTTTAATAACAGG - Intergenic
1052748085 9:32461078-32461100 GGGAAATCAGTCTGAATAACAGG + Intronic
1056582313 9:87899320-87899342 AGGAATTGAATATTAATAAAAGG + Intergenic
1057429680 9:94981953-94981975 TGGAAATCATTTTTAAAAAGTGG + Intronic
1058328001 9:103722170-103722192 TGGAAAACCAGACTAATAACTGG - Intergenic
1058547593 9:106077485-106077507 TAACAATGAATATTAATAACTGG - Intergenic
1058558192 9:106193329-106193351 TAGAAATCAATAATAACAAGAGG - Intergenic
1058666595 9:107323312-107323334 TGAAAATTAATGGTAATAACCGG + Intronic
1059858322 9:118427269-118427291 TGGAAATCACAAGTAAGAACTGG + Intergenic
1060070219 9:120540583-120540605 TGGAATTCAATGTGAACAACTGG + Intronic
1060322404 9:122575794-122575816 TACAATTCAATATTATTAACTGG + Intergenic
1203434092 Un_GL000195v1:121239-121261 TGGAGATCAAGAATGATAACAGG - Intergenic
1186160810 X:6775392-6775414 TGTAAATGAATGTTAATAGCAGG - Intergenic
1187155295 X:16715735-16715757 TGGAAAACAAATTTGATAACAGG + Intergenic
1187645820 X:21345899-21345921 GGGAAATGAGGATTAATAACAGG + Intergenic
1187855769 X:23635113-23635135 TAGAAATCTATAAAAATAACTGG + Intergenic
1188948555 X:36338890-36338912 GTGAAATCAATATTAATACAGGG - Intronic
1189720069 X:43906708-43906730 TGAAATTCAAATTTAATAACTGG - Intergenic
1192348191 X:70330279-70330301 TGGGGATCAATATTAACAATAGG - Exonic
1193222598 X:78944390-78944412 TTGAAATCAAAATTAAGAAGGGG + Intergenic
1193253884 X:79324529-79324551 TGGCGATCAGTATTAACAACAGG - Intergenic
1193563976 X:83054968-83054990 AGGAATTCAATAATAATAAAGGG - Intergenic
1194060685 X:89192981-89193003 TGGAATTGAATATGAATAAAAGG + Intergenic
1194776170 X:97967866-97967888 TGTAAATCAACATTTATAATGGG + Intergenic
1195896988 X:109755573-109755595 TAGAAATCAATAATAATGAGAGG + Intergenic
1196362352 X:114877775-114877797 TGAAACTAAAAATTAATAACGGG - Intronic
1199507024 X:148574502-148574524 TGGAAATCTTTCTTAATAATAGG + Intronic
1200662846 Y:5982138-5982160 TGGGAATAAATATTAATTATTGG - Intergenic
1200900024 Y:8421053-8421075 TAGAAATCAATGATAATAAATGG + Intergenic