ID: 1027744233

View in Genome Browser
Species Human (GRCh38)
Location 7:82053636-82053658
Sequence ACGTATCTCCAGAAGCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027744230_1027744233 7 Left 1027744230 7:82053606-82053628 CCAGTAATACCAGGAGCTGAAAC 0: 1
1: 0
2: 0
3: 10
4: 136
Right 1027744233 7:82053636-82053658 ACGTATCTCCAGAAGCAGAGTGG 0: 1
1: 0
2: 0
3: 7
4: 112
1027744231_1027744233 -2 Left 1027744231 7:82053615-82053637 CCAGGAGCTGAAACCAGTAATAC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1027744233 7:82053636-82053658 ACGTATCTCCAGAAGCAGAGTGG 0: 1
1: 0
2: 0
3: 7
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027744233 Original CRISPR ACGTATCTCCAGAAGCAGAG TGG Intronic
902091950 1:13910610-13910632 AGGCTTCCCCAGAAGCAGAGCGG + Intergenic
902096920 1:13953275-13953297 AAGTATCTCCAGATTCTGAGAGG - Intergenic
902852151 1:19167698-19167720 ACGTTTCTCCAGAATCATAGTGG - Intronic
904722832 1:32523537-32523559 AGGGCCCTCCAGAAGCAGAGCGG + Intronic
907248044 1:53120512-53120534 AGGTACTTCCAGGAGCAGAGTGG - Intronic
910168118 1:84349059-84349081 AAGTATCAGGAGAAGCAGAGGGG + Intronic
914442452 1:147719321-147719343 AGCTATGTCCAGAAGCTGAGCGG - Intergenic
916121289 1:161530653-161530675 ACCCCTCTACAGAAGCAGAGGGG - Intergenic
916131056 1:161612258-161612280 ACCCCTCTACAGAAGCAGAGGGG - Intronic
918870818 1:189971767-189971789 ACGTATCTTCAGAAGCTGTCTGG - Intergenic
920173059 1:204083582-204083604 AGGTAACTCCAGAAGCACATTGG + Intronic
922903681 1:229157698-229157720 CCTGAGCTCCAGAAGCAGAGTGG + Intergenic
923896494 1:238275951-238275973 GGAGATCTCCAGAAGCAGAGAGG - Intergenic
1071664211 10:87538047-87538069 CAGTGACTCCAGAAGCAGAGGGG - Intronic
1076350463 10:129811606-129811628 ACGGGTCTCCAGGAGCACAGAGG + Intergenic
1079720815 11:23811466-23811488 CCATATCACCAGAAGCAAAGAGG - Intergenic
1081514183 11:43809087-43809109 ACGTATGACCAGAATCAAAGTGG - Intronic
1084030457 11:66477828-66477850 GAGCATCTCCAGAGGCAGAGAGG + Intergenic
1084316189 11:68347232-68347254 AGGAATGTCCAGAAGCAGGGTGG + Intronic
1086208321 11:84286873-84286895 ATCTCTCTGCAGAAGCAGAGAGG + Intronic
1088618618 11:111659521-111659543 ATGTGTCTCAAGAAGCAGAGAGG - Intronic
1089991429 11:122864876-122864898 AAGTATGTCAAGAAGCCGAGAGG - Intronic
1099596295 12:84670981-84671003 ACACATGTCTAGAAGCAGAGGGG + Intergenic
1104118237 12:125771492-125771514 AGGTCTCCCCAGAAACAGAGCGG - Intergenic
1107050639 13:36044549-36044571 ACATATCTCAAGAAACAGATAGG + Intronic
1107327305 13:39258256-39258278 TGGTATCTCCTGAAGCAGGGAGG + Intergenic
1107327626 13:39262045-39262067 TCTTCTCTCCAGAATCAGAGAGG - Intergenic
1109901705 13:68781175-68781197 ATGTATTTGCGGAAGCAGAGTGG - Intergenic
1111775991 13:92662621-92662643 AAGTAGCTCCAGTAGCTGAGTGG - Intronic
1113913622 13:113856829-113856851 CCGTCCCTGCAGAAGCAGAGAGG - Intronic
1117030263 14:51661620-51661642 AAATATCTCCAGCAGAAGAGTGG + Intronic
1129149447 15:73678657-73678679 GCCTATCTCCAGGAGAAGAGGGG + Intergenic
1129325070 15:74795562-74795584 ACCTGTCTCAGGAAGCAGAGGGG - Intronic
1131417858 15:92276392-92276414 GAGTAGCTCCAGGAGCAGAGTGG + Intergenic
1132859424 16:2062704-2062726 AGGGCTCTCCAGAGGCAGAGGGG - Intronic
1136777896 16:32881393-32881415 ACCTCTCTCCAGAAGAGGAGGGG - Intergenic
1136892726 16:33980121-33980143 ACCTCTCTCCAGAAGAGGAGGGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141184032 16:81774425-81774447 CCCTACCTCCAGAAGCAGTGAGG + Intronic
1141308846 16:82893795-82893817 AAGTGTCTCGAGATGCAGAGTGG - Intronic
1203080314 16_KI270728v1_random:1143502-1143524 ACCTCTCTCCAGAAGAGGAGGGG - Intergenic
1146521813 17:33531432-33531454 ACGCCTCTCAAGAAGCAGAGAGG - Intronic
1149739132 17:59026860-59026882 ATGCATCTCAAGAAGTAGAGTGG - Intronic
1150612038 17:66740950-66740972 ACGTGTCTACACGAGCAGAGAGG - Intronic
1151518968 17:74615001-74615023 ACGAATCTCCAGCAACAGAGAGG - Intronic
1152017087 17:77757843-77757865 ACGTCTCTCCAGAGGAAGACTGG + Intergenic
1154370623 18:13758914-13758936 TTGTATCTCCAGGAACAGAGAGG + Intronic
1156549378 18:37999481-37999503 ACGTCTCTTCAGAATAAGAGAGG - Intergenic
1158693214 18:59680270-59680292 ACTTATCTCAGGGAGCAGAGGGG + Intronic
1160019861 18:75172014-75172036 ACGTATCCCCCGAAGATGAGGGG - Intergenic
1162177567 19:8842543-8842565 ACCTATCCCCAGAGGGAGAGAGG + Intronic
1163694416 19:18756653-18756675 ACAAATGTCCAGCAGCAGAGAGG + Intronic
1167976167 19:53227628-53227650 ACGTCTCCCCAGCAGCTGAGAGG + Intergenic
1168604423 19:57747134-57747156 ACCTAAGTCCAAAAGCAGAGAGG + Intronic
928276662 2:29907125-29907147 AGGAAACTCCAGAAGCAGACAGG + Intronic
933610012 2:84424010-84424032 TCCTAAATCCAGAAGCAGAGAGG + Intronic
935283977 2:101547143-101547165 ATGTTTCTGCAGAAGCAGAATGG - Intergenic
938553324 2:132400617-132400639 AGGTATCTCCAGAGGCATAATGG + Intergenic
940818159 2:158319476-158319498 AACAATGTCCAGAAGCAGAGAGG - Intronic
940987025 2:160061147-160061169 ACTTATCTCCAAAGGCAGAGAGG + Intronic
942659266 2:178246787-178246809 AGGTAACTCTAGAAGCAGAATGG - Intronic
1173284735 20:41659949-41659971 AAGTATATTCAGCAGCAGAGGGG - Intergenic
1174362611 20:50038450-50038472 ATGGAAGTCCAGAAGCAGAGAGG - Intergenic
1175507201 20:59494419-59494441 ACATGTCTCTAGAAGCACAGGGG + Intergenic
1176677074 21:9788983-9789005 AAGTATTTCCTGAAGCAGACTGG + Intergenic
1177215514 21:18123308-18123330 CCGTATCTACAGGAGCAGAGTGG - Intronic
1178429529 21:32506801-32506823 ACCTCTCTCCAGCAGCAGTGAGG - Intronic
1178731619 21:35108234-35108256 AAATATCTCCAGATCCAGAGGGG - Intronic
1179841012 21:44073556-44073578 AAGTAAATACAGAAGCAGAGAGG + Intronic
1181495274 22:23284073-23284095 ACCAAGCTCAAGAAGCAGAGCGG + Exonic
1185025814 22:48411284-48411306 AGGTTTCTTCAGAAGGAGAGAGG + Intergenic
950567268 3:13777611-13777633 ATGTGCCTCCAGTAGCAGAGGGG + Intergenic
950720712 3:14880725-14880747 ACGTATCTGCAGAGGGAAAGAGG - Exonic
951530068 3:23690585-23690607 TTGTATCTCCAGGAGTAGAGAGG + Intergenic
955328385 3:58027050-58027072 ACGGGTCTCCAGAAGGGGAGTGG - Intronic
958118292 3:89251142-89251164 AAGTATCTCCAGAAGAACATTGG - Intronic
959267598 3:104162880-104162902 ACATATTTCCAGATGAAGAGAGG - Intergenic
959472492 3:106769335-106769357 ACCTATTTCCAGAAGCAATGTGG + Intergenic
961369788 3:126422407-126422429 CCTGATCCCCAGAAGCAGAGAGG - Intronic
966877075 3:184328566-184328588 ACGTTGCCCCAGAAGGAGAGTGG + Intronic
967742342 3:193017159-193017181 ACATATCTCCACAAGTAGATCGG - Intergenic
968649687 4:1755610-1755632 TGGTACCGCCAGAAGCAGAGAGG + Intergenic
968826148 4:2898961-2898983 ACATAAGTCAAGAAGCAGAGGGG - Intronic
972260612 4:37404733-37404755 AGGCCTCTCCAGAAGCTGAGCGG - Intronic
974906347 4:68063188-68063210 AAGTATCTCCAGAGGCAGTTGGG - Intronic
975716930 4:77214143-77214165 ACTTAGTGCCAGAAGCAGAGAGG - Intronic
983061165 4:163162371-163162393 ACCTATCTCTAGCAGCACAGTGG + Intronic
985227290 4:187775479-187775501 ATCTATCTCATGAAGCAGAGGGG + Intergenic
985267116 4:188160573-188160595 CCCTGGCTCCAGAAGCAGAGAGG - Intergenic
985398472 4:189569803-189569825 AAGTATTTCCTGAAGCAGACTGG - Intergenic
985506326 5:283109-283131 TCGTAGCTGCAGAATCAGAGAGG + Intronic
985980838 5:3461783-3461805 AGGTAACTCCTGAAGCTGAGTGG - Intergenic
989952364 5:50314947-50314969 ACGCTTCTTCAGAAGTAGAGGGG + Intergenic
990518047 5:56549158-56549180 CAGTATCTGCAGAGGCAGAGTGG + Intronic
992035404 5:72769792-72769814 AGCCACCTCCAGAAGCAGAGAGG + Intergenic
992286715 5:75242998-75243020 ATGTTTCTTCAGAAGCAGAAAGG + Intergenic
993251442 5:85529679-85529701 ATGTATTTTCAAAAGCAGAGAGG - Intergenic
994058977 5:95452797-95452819 ACATAGCTACAAAAGCAGAGAGG + Intergenic
1000229637 5:159303448-159303470 AGGCCTCACCAGAAGCAGAGCGG - Intergenic
1000628515 5:163566125-163566147 ACGTATCTGCAGAACAAGAATGG - Intergenic
1002071137 5:176679612-176679634 ATGTATGTCTTGAAGCAGAGGGG - Intergenic
1004819617 6:19353142-19353164 TGGTATCCCCAGAAGCAGACAGG - Intergenic
1006133457 6:31882332-31882354 AAGAACATCCAGAAGCAGAGAGG + Intronic
1008374852 6:50779884-50779906 AGTTATCTCCAGAGGAAGAGTGG + Intergenic
1018432508 6:163733617-163733639 AGGCTACTCCAGAAGCAGAGGGG - Intergenic
1026211351 7:68308493-68308515 ACTCCTCTACAGAAGCAGAGCGG - Intergenic
1027744233 7:82053636-82053658 ACGTATCTCCAGAAGCAGAGTGG + Intronic
1029508195 7:100975633-100975655 TCGTAGCTCCAGCAGCAGATTGG - Intronic
1042711075 8:71718351-71718373 AAGTATCTCCAGTGGCAGAGAGG - Intergenic
1047764248 8:127977381-127977403 AGGTATCTCCTGCAGCAGATGGG - Intergenic
1053375274 9:37600771-37600793 ACTTCTCTCCAGAAACACAGAGG + Intronic
1057149417 9:92783193-92783215 AGGCGTCACCAGAAGCAGAGAGG - Intergenic
1061885656 9:133590016-133590038 ACTTAAGTCCAGCAGCAGAGAGG - Intergenic
1187129056 X:16483296-16483318 AAGTATCTTCAGAATCAAAGAGG - Intergenic
1189611103 X:42736777-42736799 TCGTAACTCCAGAAGAAGAAAGG - Intergenic
1192613551 X:72592835-72592857 AACTATGGCCAGAAGCAGAGAGG + Intronic
1194988411 X:100517752-100517774 CCTTATCTACAGGAGCAGAGTGG - Intergenic
1195281938 X:103344697-103344719 AGGCCTCTCCAGAAGCAGAAAGG - Intergenic
1200101938 X:153692643-153692665 ACCTCTCTCCAGAAGAGGAGGGG + Intronic
1201982805 Y:19925671-19925693 AAGTAGCTCCAGATGGAGAGTGG + Intergenic