ID: 1027744478

View in Genome Browser
Species Human (GRCh38)
Location 7:82056335-82056357
Sequence TTGGAGAAGCAACATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027744473_1027744478 26 Left 1027744473 7:82056286-82056308 CCAAAGTCCTAAAAGGATCAAGA 0: 1
1: 0
2: 1
3: 10
4: 182
Right 1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG No data
1027744476_1027744478 -9 Left 1027744476 7:82056321-82056343 CCTCATACATAGTTTTGGAGAAG 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG No data
1027744474_1027744478 19 Left 1027744474 7:82056293-82056315 CCTAAAAGGATCAAGATTAGAAG 0: 1
1: 0
2: 0
3: 18
4: 235
Right 1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027744478 Original CRISPR TTGGAGAAGCAACATGAGGA TGG Intronic
No off target data available for this crispr