ID: 1027747815

View in Genome Browser
Species Human (GRCh38)
Location 7:82099743-82099765
Sequence GTTTAAGAAGGTATTGCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027747815_1027747821 10 Left 1027747815 7:82099743-82099765 CCGGCCGCAATACCTTCTTAAAC 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1027747821 7:82099776-82099798 GAGTGTGTGTGAATCACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027747815 Original CRISPR GTTTAAGAAGGTATTGCGGC CGG (reversed) Intronic
901545033 1:9949750-9949772 CTTTAAGAATGTAGTGGGGCCGG - Intronic
903609694 1:24601607-24601629 CTTTAAAAAGGTATCGTGGCCGG + Intronic
905089145 1:35413325-35413347 GTTTAAAAATGTATTGAGCCAGG - Intronic
905804376 1:40865157-40865179 GTTTAAGAAGTTCTTTAGGCCGG + Intergenic
905818332 1:40969488-40969510 TTTTAAAAATGTATTGTGGCTGG + Intergenic
906471688 1:46136140-46136162 GAAAAAGAAGGTATTGAGGCTGG - Intronic
907089021 1:51707354-51707376 CATTAAGAAGGTATTGAAGCAGG - Intronic
916049386 1:161024661-161024683 GGTTAAGAAAGAAATGCGGCTGG - Intronic
916057580 1:161078713-161078735 GTTTAAAAAGTGATTGTGGCTGG + Intronic
916822520 1:168413549-168413571 GTTTTAGAAAGTATTTAGGCAGG + Intergenic
922622840 1:227004105-227004127 GTTTAAGAAGGGGCTGAGGCAGG - Intronic
1070064089 10:73016478-73016500 CTTTAACAATGTAATGCGGCCGG + Intronic
1072304008 10:94089098-94089120 GTTTCAGAAGGAAGTGCAGCAGG + Intronic
1072488268 10:95877339-95877361 GGTTAAGAAGGGATTGCAGTTGG - Intronic
1076743328 10:132499154-132499176 TTTTAAGAAGACATTGGGGCTGG - Intergenic
1081261577 11:40968175-40968197 GCTTAAGAAAATATTGTGGCTGG - Intronic
1085672173 11:78477367-78477389 GCTTAAGAGAGTATTGGGGCAGG - Intronic
1086562370 11:88182884-88182906 GTTGAAGAAAATATTGCAGCTGG + Intergenic
1088635551 11:111816854-111816876 GTTTAAGAATGACTTGGGGCTGG - Intronic
1089435110 11:118458381-118458403 TTTTAAGAATGTATAGGGGCAGG - Intronic
1095783712 12:46087529-46087551 GTTTTAGAAGATAGTGCTGCTGG + Intergenic
1099459687 12:82907165-82907187 CTTTAAGAATGAATTGGGGCCGG + Intronic
1099756092 12:86850913-86850935 GTATAAGAAGAAATTGCTGCAGG + Intergenic
1105363197 13:19740045-19740067 ATTTAAGAATGAATTGGGGCCGG + Intronic
1109040467 13:57328863-57328885 GTTTAAGAAGTTAAAGGGGCCGG - Intergenic
1109368188 13:61385453-61385475 CCTAAGGAAGGTATTGCGGCAGG + Intergenic
1113239340 13:108318938-108318960 GTATGAGATGGTATTGCAGCAGG + Intergenic
1114666491 14:24380291-24380313 CTATAAGAAGGGATTGCGGAGGG + Intergenic
1115022696 14:28701961-28701983 GGTTAATAAGGTATTGAGGGTGG + Intergenic
1116358139 14:43957401-43957423 GTTTAAGAAGCTTTTGGGGCCGG - Intergenic
1118487986 14:66232232-66232254 GTTTAAGAGGGTCCTGCGGTAGG + Intergenic
1124377495 15:29137536-29137558 GTTTAAGACGGCACTTCGGCTGG + Intronic
1128945942 15:71821004-71821026 TTTTAAGAATGTATTTCGGCTGG + Intergenic
1132475311 16:133123-133145 GTTTAAGAGAATATTGTGGCTGG + Intronic
1133140088 16:3737249-3737271 GTTTCAGAAGGGAATGGGGCAGG + Intronic
1138479685 16:57294059-57294081 TTTTAAAAAGATATTGTGGCCGG + Intergenic
1141455337 16:84137489-84137511 GTTTAGGAAGGTAACGCAGCAGG + Intronic
1145956592 17:28858957-28858979 GTGTCAGAAGGTATTGCTGTGGG - Exonic
1148988253 17:51642937-51642959 ATTTAAAAAGGTATGGTGGCTGG - Intronic
1153757449 18:8298734-8298756 GGTTAATAAGGTATGGAGGCAGG + Intronic
1156808448 18:41216995-41217017 ATTTAAGAAGGTAATTTGGCAGG + Intergenic
1157405825 18:47421965-47421987 CTTTAAGAAGTTATTGATGCAGG - Intergenic
1161451502 19:4348553-4348575 GTTTAAGAAGAAATTTAGGCCGG - Intronic
1165543651 19:36514695-36514717 GTTTAATGAGGTATTGCTTCTGG + Exonic
1167827698 19:51988755-51988777 GTTTGAGAATGTAATGAGGCTGG - Intergenic
928119476 2:28573257-28573279 GTTTAAGAAGGCATTAGGACTGG - Exonic
928950406 2:36808581-36808603 GTTCAAGCAGGTCTTGCTGCAGG - Exonic
932689870 2:73903092-73903114 GTTTAAGAAAATATTGTGGGGGG + Intronic
933063781 2:77769567-77769589 CTTTAAGAAAGTAATGTGGCTGG + Intergenic
939891416 2:147741420-147741442 GTTTAAGAAAGTATTTGGGTTGG + Intergenic
941576710 2:167241704-167241726 GTTTAAGAAGAAATTATGGCTGG - Intronic
945442837 2:209900866-209900888 GTTTAAGAGAATATTGTGGCTGG - Intronic
945838525 2:214860630-214860652 CTTTAAAAAAGTATTTCGGCTGG - Intergenic
948043651 2:234926007-234926029 GTTTAAGAAAATACTGTGGCTGG - Intergenic
1177842568 21:26250842-26250864 GTTTAGGCAGGTAGTGCTGCAGG - Intergenic
1178152309 21:29809523-29809545 GCTTAAGAGGCTCTTGCGGCTGG + Intronic
1178841434 21:36140709-36140731 GGTTAAGAAGTTTTTGTGGCCGG + Intronic
952462356 3:33541309-33541331 TTTTAAGAAGGAGTTGGGGCTGG - Intronic
957200991 3:77135704-77135726 GTGTATTAAGATATTGCGGCTGG - Intronic
957575029 3:81996243-81996265 GTTTAAAAAGTTATTGGAGCTGG - Intergenic
957881236 3:86215797-86215819 TTTTAAGGAGGTATTTCTGCAGG + Intergenic
959210194 3:103369056-103369078 GTTTAAGAAAATGTTGTGGCTGG + Intergenic
959740601 3:109714803-109714825 GTATAAGAAGGTATTTGGGCCGG - Intergenic
960407496 3:117279631-117279653 TTTTAAGAAGCTATTGCCTCTGG + Intergenic
963584480 3:147167158-147167180 GTCTAAAAAAGTATTGTGGCTGG + Intergenic
965126322 3:164634747-164634769 ATTTAAGAAGGTAGTGTTGCAGG - Intergenic
965581178 3:170269363-170269385 ATTTAAGAAGGCTTTGAGGCTGG + Intronic
965905627 3:173701941-173701963 GTTTAAGAAGAGTTTTCGGCCGG + Intronic
967276813 3:187784285-187784307 GTTTGAAAAGGTCTTGTGGCTGG + Intergenic
967606203 3:191449979-191450001 GTTTAAGAAAACATTGAGGCCGG + Intergenic
973550213 4:52026551-52026573 GTTTAAGAAGCAATTTAGGCCGG - Intronic
975408720 4:74022827-74022849 CTTTAAGAATGTATTGTGGCCGG - Intergenic
976468526 4:85399719-85399741 GTTTAAGAGGATGTTGTGGCTGG - Intergenic
977025003 4:91807226-91807248 GTTTAACAATATATTGCAGCTGG - Intergenic
977254931 4:94730041-94730063 GTTTAAGAAGATAATGATGCTGG + Intergenic
979861630 4:125700309-125700331 TTTTAAGAAGCTTTTGGGGCGGG - Intergenic
982543916 4:156709581-156709603 GTTTAAGAAGGAAGTGAAGCCGG - Intergenic
982640276 4:157950198-157950220 TTTTAAGAAGATAATCCGGCCGG + Intergenic
985385243 4:189439499-189439521 GTTTGAGAATGCATTGAGGCTGG + Intergenic
996364773 5:122689429-122689451 GTACAAGAAGGTAGTGAGGCTGG + Intergenic
996558159 5:124800046-124800068 TTTAAACAATGTATTGCGGCCGG + Intergenic
996650120 5:125865658-125865680 GTTTAAGAAGGCATTGACACAGG + Intergenic
1001606915 5:172967166-172967188 GTTTAATAAGCTCTTGTGGCTGG + Intronic
1001637753 5:173224520-173224542 ATTTAAGAATGTCTTGGGGCTGG + Intergenic
1002825825 6:773430-773452 GCTTAAGAAGCTTTTGAGGCTGG + Intergenic
1003094093 6:3129053-3129075 GTTTAAGAAGGTTTCTCTGCTGG + Exonic
1003473206 6:6456639-6456661 GCTTAAGAAAATATTGTGGCTGG - Intergenic
1004795551 6:19079700-19079722 GTATAAGAAGCTCTTCCGGCCGG + Intergenic
1005045865 6:21641799-21641821 GCTTAAGGAGTTATTGTGGCTGG - Intergenic
1008915954 6:56786815-56786837 GGTTAAAAAGGTATTGGGGTTGG - Intronic
1009768631 6:68116657-68116679 GTATAAGAAGGTTCTGCTGCAGG + Intergenic
1010341767 6:74761943-74761965 GTTTAAGAAGATAGGGAGGCTGG + Intergenic
1010567607 6:77435620-77435642 GTTTAATAAGGTATTATAGCTGG + Intergenic
1021892835 7:25203621-25203643 ATTTAAGAAGGCATTCTGGCCGG - Intergenic
1022281743 7:28917676-28917698 GTTTAAGAAATCTTTGCGGCTGG - Intergenic
1022300773 7:29100216-29100238 GTTTAGGAAGGAAGTGGGGCTGG - Intronic
1024762945 7:52622276-52622298 GTTTAAGAAAGTTTTGGGCCTGG + Intergenic
1025028770 7:55538977-55538999 GGTTGAGAAGGTATTGGGGAGGG + Intronic
1027057928 7:75063092-75063114 GTTTAATAAGATTTTGGGGCCGG - Intronic
1027747815 7:82099743-82099765 GTTTAAGAAGGTATTGCGGCCGG - Intronic
1029192900 7:98784475-98784497 GTTAAAGAAGCAATTGCGGCTGG + Intergenic
1039440594 8:37592601-37592623 GTTTAAAAATGGAATGCGGCCGG - Intergenic
1039724862 8:40205107-40205129 GTTTGAGAAGGTACTGCTTCGGG - Intergenic
1043281519 8:78473073-78473095 GTTGATGAAGGTATTGTGACTGG + Intergenic
1045507718 8:102790365-102790387 GTTTAAGAAATGTTTGCGGCTGG - Intergenic
1047928814 8:129706107-129706129 GTTTAGGAAGGTGATGCTGCTGG + Intergenic
1049922990 9:382433-382455 GTTTAAGAAGGAATTGAAGAGGG - Intronic
1050812048 9:9760444-9760466 AGTTAAGAAGGTATTGGAGCAGG - Intronic
1051753649 9:20371052-20371074 GTTTAAGGAAGTGTTGTGGCTGG - Intronic
1055526427 9:77138347-77138369 CTTTAAGAAGTGATTGGGGCCGG - Intergenic
1056085963 9:83149501-83149523 GTGTAAGAAGGCATTGAGGCAGG + Intergenic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1186255984 X:7720344-7720366 GCTTAAGAGAGTATTGTGGCTGG + Intergenic
1187766758 X:22651025-22651047 GTTAAAGAAGGTACTGAGGGAGG - Intergenic
1187777808 X:22783232-22783254 GCTTAAGAAGGTATTGAGGAGGG + Intergenic
1189396478 X:40627485-40627507 GTTTAACAATGTATAGCAGCTGG - Intronic
1190167144 X:48082713-48082735 GGTTATGAAGGTATTGCTGCAGG - Intergenic
1196688411 X:118532482-118532504 GTTGAAGAAGGTGTGCCGGCCGG + Intronic