ID: 1027748310

View in Genome Browser
Species Human (GRCh38)
Location 7:82107427-82107449
Sequence AGGGAGAAGCAGAGAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4637
Summary {0: 1, 1: 1, 2: 49, 3: 563, 4: 4023}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027748310_1027748316 29 Left 1027748310 7:82107427-82107449 CCTTCCTCTCTCTGCTTCTCCCT 0: 1
1: 1
2: 49
3: 563
4: 4023
Right 1027748316 7:82107479-82107501 CAAAGCCCAGCCTCCACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027748310 Original CRISPR AGGGAGAAGCAGAGAGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr