ID: 1027748762

View in Genome Browser
Species Human (GRCh38)
Location 7:82113909-82113931
Sequence GATGCCAATATTAAGATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027748761_1027748762 23 Left 1027748761 7:82113863-82113885 CCAGGAAAGGTTAGAGTCTTACT 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1027748762 7:82113909-82113931 GATGCCAATATTAAGATGAATGG 0: 1
1: 0
2: 0
3: 19
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027748762 Original CRISPR GATGCCAATATTAAGATGAA TGG Intronic
900758268 1:4452879-4452901 AATGCCAATCTAATGATGAATGG + Intergenic
901621661 1:10593477-10593499 CATATCAATATTAAGATGATGGG + Intronic
903259818 1:22125424-22125446 GATGCCAATATTGAGGATAAAGG + Intronic
903288977 1:22295768-22295790 GATGCTCACATTAAGAGGAATGG - Intergenic
905875680 1:41430914-41430936 GATGTCCATATTCACATGAAGGG + Intergenic
907646572 1:56250519-56250541 GAGGCCATTTTTCAGATGAAAGG - Intergenic
908887519 1:68806658-68806680 GTTGACAAAATTAAAATGAAAGG - Intergenic
908974031 1:69876036-69876058 GATGCCAATAAAATGATGAAAGG - Intronic
909281241 1:73756288-73756310 CATGCCAACATTAAGTTGATTGG + Intergenic
909381823 1:75007070-75007092 GATGTAAATTTTAAAATGAAGGG - Intergenic
912263894 1:108135600-108135622 GATACCTATATTTAAATGAAAGG - Exonic
912403435 1:109416054-109416076 GATGACAATAATAATAAGAAGGG + Intronic
916286759 1:163114715-163114737 GATACCAATATCAAAATTAAAGG + Intronic
919430876 1:197489655-197489677 AATGCTAATATTAAGATGTGAGG - Intergenic
921403979 1:214758644-214758666 AATGTCAATATTAAGTTTAATGG + Intergenic
922262766 1:223957438-223957460 GATGGCAATGTTAAGTAGAATGG - Intergenic
922388829 1:225116684-225116706 GATGTCAGCATTAAGATGTATGG + Intronic
924344604 1:243062439-243062461 GATGGCAATGTTAAGTAGAATGG - Intergenic
924689843 1:246336181-246336203 GTTGCCAATGTACAGATGAATGG + Intronic
1062872114 10:914409-914431 AATGCCAATATAAAAAAGAAAGG + Intronic
1067302868 10:45029795-45029817 CATGCCAAACTTAAGATAAAAGG - Intergenic
1067535703 10:47108334-47108356 GATGCCAATTTCAAGAGTAAGGG - Intergenic
1071242975 10:83728600-83728622 GATGCCAATATTGAAATGTGTGG - Intergenic
1073632831 10:105165883-105165905 GATGGTAAAATTAAGAGGAAAGG + Intronic
1075230131 10:120669186-120669208 GATTCCAATGTAAAGATGGATGG + Intergenic
1075478745 10:122760483-122760505 GATGCAAGCTTTAAGATGAAGGG - Intergenic
1079615621 11:22489014-22489036 AAAGCCAATATTGGGATGAAGGG + Intergenic
1080566827 11:33517376-33517398 AATGCAAACATAAAGATGAAGGG + Intergenic
1080732729 11:34976615-34976637 GATGCCAACATTGAGAGGAAAGG + Intronic
1082129130 11:48466487-48466509 GATGATAAGATTAAGATGGAAGG - Intergenic
1082248285 11:49950924-49950946 GATGATAAGATTAAGATGTAAGG + Intergenic
1082562665 11:54637442-54637464 GATGATAAGATTAAGATGGAAGG - Intergenic
1082928212 11:58573799-58573821 AATATCAATATTAACATGAAAGG + Intronic
1089237829 11:117047972-117047994 AATACTAATATTAAGATGAATGG - Intronic
1090498586 11:127239547-127239569 GTTGGCAATATTAACATCAAAGG - Intergenic
1090517457 11:127444225-127444247 GGTGCAAATGTTAAGATTAAGGG + Intergenic
1090945749 11:131428168-131428190 GATCCCAATAATAACATCAAGGG - Intronic
1092034216 12:5316989-5317011 TATGCCAAAATTGAGATGACAGG + Intergenic
1099367372 12:81784560-81784582 TCTGCCCATATTAAGATGTATGG + Intergenic
1099635753 12:85209013-85209035 GTTGCCAATATTAAGGTAACTGG - Intronic
1101197545 12:102400410-102400432 GATACCAATTTTCAGTTGAATGG + Intronic
1105282488 13:18976248-18976270 TATGCCTATATTTAGGTGAAAGG - Intergenic
1108142892 13:47444529-47444551 GATGAGAATATTAAGGTGAATGG - Intergenic
1108852559 13:54751241-54751263 GATGTTAATATTAAGAGGAAAGG + Intergenic
1110642063 13:77836560-77836582 TATGCCCATATGTAGATGAAAGG + Intergenic
1110754539 13:79157154-79157176 AATGCAATTATTAAGATGGAAGG - Intergenic
1111161363 13:84398950-84398972 GGTGTCAGTATTAAGTTGAACGG - Intergenic
1111386863 13:87538991-87539013 GATGACAGTTTTAAAATGAATGG + Intergenic
1112777540 13:102861622-102861644 GAAGGCAGTATGAAGATGAAGGG + Exonic
1113994552 14:16055471-16055493 GAGGCCATTATTAAGAGGGACGG + Intergenic
1117537611 14:56717014-56717036 GATGGCATTCTTAAGATGATTGG + Intronic
1117904298 14:60568337-60568359 GATGCCAAAATTAAGAGGATAGG + Intergenic
1118524993 14:66630119-66630141 GATGACAATATGAAGATCTAAGG + Intronic
1118529885 14:66691833-66691855 GAAGCCAAAATTAAGATATAGGG + Intronic
1125395809 15:39246362-39246384 TATGCCCATATTAGGGTGAAAGG - Intergenic
1127141125 15:55978356-55978378 AATGCAAATATTAAAATAAATGG - Intronic
1128196714 15:65764178-65764200 GATACAAATATTAAGTTTAATGG - Intronic
1129547727 15:76416009-76416031 ATTTGCAATATTAAGATGAAGGG + Intronic
1133686013 16:8166169-8166191 GAGGCCAAAACTAAGGTGAATGG - Intergenic
1133823971 16:9260789-9260811 CATGACAATAATAAAATGAAAGG - Intergenic
1139032888 16:62906749-62906771 AATTCCAATATTTAGAAGAACGG - Intergenic
1139295044 16:65893347-65893369 GATGTCAATATTGAGATGACAGG - Intergenic
1141358246 16:83369881-83369903 GAAGTCAAAATTAAGGTGAATGG + Intronic
1145015755 17:19397041-19397063 GATGCCAACACTGAGATGACTGG - Intergenic
1148449497 17:47766779-47766801 GATGCCAACATTGAGACGACAGG - Intergenic
1149170453 17:53803841-53803863 GATGCCGAGGTTAAGATAAAGGG + Intergenic
1150679857 17:67276059-67276081 GAGGCCAATAAAAAGGTGAAAGG - Intergenic
1153092877 18:1368708-1368730 TATGCTAATATTAAGAGGCAAGG - Intergenic
1154098672 18:11446931-11446953 AATGTCAATATTAATATGACTGG + Intergenic
1156259387 18:35430497-35430519 GATGCCAATAATAACAGGACTGG + Intergenic
1156805190 18:41169972-41169994 GATGCAAAAATTAAAATGATTGG + Intergenic
1158312795 18:56176999-56177021 GATTCCAATACAAATATGAATGG + Intergenic
1159138350 18:64363092-64363114 GTTGAGAATTTTAAGATGAAGGG - Intergenic
1159297048 18:66505196-66505218 TATTCCAATATGATGATGAAGGG - Exonic
1163957713 19:20659818-20659840 GCAGTCAAGATTAAGATGAAAGG - Intronic
1166580904 19:43898384-43898406 GATGACAATAATAAAAAGAAAGG + Intronic
926711453 2:15885301-15885323 GATGCCCATGTGTAGATGAAGGG + Intergenic
927034572 2:19160677-19160699 GATGTCAATAAAAAGATGAGTGG - Intergenic
930354142 2:50296105-50296127 TATGACTATATAAAGATGAATGG + Intronic
930758038 2:54998640-54998662 AATGGGAATATAAAGATGAAAGG - Intronic
932948642 2:76267318-76267340 GATGGCAATTTTAAAAGGAAAGG - Intergenic
935607450 2:104985018-104985040 TATGCCAATCTTATCATGAAAGG + Intergenic
937011804 2:118569517-118569539 GATGCCAGTATTAAAATACATGG + Intergenic
938061119 2:128255004-128255026 GATGCCAATACCAAGATGACAGG + Intronic
938773363 2:134520030-134520052 CATGCCAACATAAAGATGAAGGG + Intronic
939236096 2:139495790-139495812 GATGAGAAAACTAAGATGAAGGG + Intergenic
939318709 2:140586884-140586906 GATGCCAACACCAAGATGACAGG + Intronic
941363680 2:164583482-164583504 CATGACAATATTAACATTAAGGG + Intronic
943317321 2:186406239-186406261 CATTCCAATATTAAGAAAAAGGG - Intergenic
943567651 2:189535449-189535471 GCTGCCAATAAAAAGATAAAGGG - Intergenic
943647800 2:190426703-190426725 GATGCCAACATTGAGATGACAGG - Intronic
945139605 2:206670326-206670348 GATTCCAATATGAAGGTTAAAGG - Intronic
947944698 2:234091606-234091628 GATGCCAATTTTCTGTTGAATGG - Intergenic
1170442774 20:16395448-16395470 GATGACAACATTTATATGAAAGG - Intronic
1175037943 20:56017973-56017995 GATGCCAAGATAAAGAAGGATGG + Intergenic
1175752106 20:61505809-61505831 GCTGCTTATGTTAAGATGAATGG + Intronic
1177353824 21:19981071-19981093 GCTGCCTCTATAAAGATGAAAGG - Intergenic
1179318171 21:40264672-40264694 ACTGCCAGTATTATGATGAATGG - Intronic
1180312539 22:11251933-11251955 GAGGCCATTATTAAGAGGGACGG - Intergenic
1181835889 22:25608206-25608228 ATTGCCACTATTAAGAAGAAAGG - Intronic
1183861710 22:40674999-40675021 GATGCAAATATAAGGTTGAAAGG + Intergenic
1184378720 22:44131730-44131752 GAACCCAATTTTAAGATGCAAGG - Intronic
949922367 3:9013277-9013299 GATAATAATATTAAGAGGAATGG + Intronic
951783516 3:26390873-26390895 GATGCTAATGTTATGATGATGGG - Intergenic
957328051 3:78721974-78721996 AATTCCAATTTCAAGATGAATGG + Intronic
957357270 3:79107281-79107303 GATGCCAATATTATCACAAAAGG - Intronic
958138074 3:89522038-89522060 GTTGCAAATAGTAAGATGAAAGG + Intergenic
958997321 3:100919447-100919469 TATACCAATATAAAGATTAAGGG + Intronic
959317670 3:104829054-104829076 GATGCTATTATTAGAATGAAGGG - Intergenic
962459933 3:135601496-135601518 GAAGCCAAAATTCAGTTGAATGG + Intergenic
964089072 3:152851494-152851516 GATGCCAACACTGAGATGACAGG + Intergenic
964976680 3:162629482-162629504 GCTGCCAAAATTAAGAAGATTGG + Intergenic
965010970 3:163090374-163090396 GATATCAATATGAAAATGAATGG + Intergenic
965082398 3:164051304-164051326 GATGTCAATTTTATGATGATTGG - Intergenic
966434275 3:179865863-179865885 AATGCCAATATCTAGATCAAAGG - Intronic
967803201 3:193687906-193687928 GGTGCAACCATTAAGATGAAGGG + Intronic
968137829 3:196231764-196231786 GAGGGCAATACTAAGATAAATGG + Intronic
970075485 4:12214453-12214475 GTTGCCAATATTAAAATGCTTGG - Intergenic
971590326 4:28459671-28459693 GATGTCAGTATGAAGATGAGAGG + Intergenic
971602577 4:28614034-28614056 GAGGCCAATATTAGGAGGAATGG + Intergenic
973272585 4:48276714-48276736 GATGCCAACACCAAGATGACAGG + Intergenic
974431739 4:61806742-61806764 TATGCCAAAATTTAGATAAAGGG - Intronic
974709486 4:65572045-65572067 GAAGCAAATATTAATATGAAGGG + Intronic
975772633 4:77744447-77744469 GAGGTGAATATTAACATGAACGG + Intronic
976118046 4:81749516-81749538 GATGCTAATTTTAAGATGATGGG + Intronic
978392503 4:108241953-108241975 TAAGCCAATATTAAGGAGAATGG + Intergenic
978406649 4:108386044-108386066 GATGCCAACATTGAGAGGATAGG + Intergenic
978878805 4:113675144-113675166 AAAGCCAATATTAAGGTGAAAGG - Intronic
979428469 4:120597359-120597381 GCTTCCAATATTATGTTGAATGG - Intergenic
980312156 4:131144706-131144728 AATGCTAATATTAAGATTCAGGG - Intergenic
982948253 4:161654713-161654735 GCAGCCAAGATTAAGAGGAAAGG + Intronic
984255396 4:177384292-177384314 GATGCCAATATTCAGACCATAGG + Intergenic
987284075 5:16438672-16438694 GATGCAATTATTATCATGAATGG - Intergenic
990824014 5:59876866-59876888 TATCCTAATACTAAGATGAAGGG + Intronic
990868446 5:60405154-60405176 AATGCCAAGAGTAAGGTGAAAGG + Intronic
992829853 5:80583654-80583676 AATGCTAATTTTAAGATCAATGG + Intergenic
994808653 5:104484420-104484442 GATGTCGATATTAATGTGAAAGG + Intergenic
995621723 5:114032955-114032977 GTTGCCAATATTAAGAGGTGGGG + Intergenic
998722221 5:144966117-144966139 GTTTCCAACATGAAGATGAAAGG - Intergenic
998787094 5:145724444-145724466 AATACCAATATTAAGGTGATTGG + Intronic
1001418593 5:171568786-171568808 GATGCCAATATGTAGAGGATAGG - Intergenic
1003093661 6:3125380-3125402 GATTCCAATATTAAAAAAAATGG + Intronic
1004032635 6:11885669-11885691 GATGCCAACACTGAAATGAATGG + Intergenic
1005233338 6:23730775-23730797 GATGCCAAAATAAAGAAGTAAGG + Intergenic
1006759750 6:36449660-36449682 GATGACAATGTGAAGATGAGAGG - Intronic
1007980845 6:46156345-46156367 CATGCCAATATTTAGAAGCATGG - Intergenic
1008209874 6:48707990-48708012 GATGTTAATAATAAGATAAATGG + Intergenic
1009052702 6:58296873-58296895 AATGCAAAAATTCAGATGAAAGG + Intergenic
1010082456 6:71880208-71880230 GATGACAAAATGATGATGAAAGG + Intergenic
1011889622 6:92141174-92141196 GATGACAATATTAAGAATATTGG - Intergenic
1012390758 6:98737003-98737025 GATGGCTATCTTAAGAAGAAAGG - Intergenic
1013605062 6:111739691-111739713 AAAGCCATGATTAAGATGAAGGG + Intronic
1015012011 6:128360680-128360702 GATGCTCATATCAACATGAAGGG - Intronic
1015204281 6:130617324-130617346 GATTCCAATATTTAGATTTAAGG - Intergenic
1015787269 6:136930763-136930785 CATGCCAATCTTAATATGCATGG - Intergenic
1018151465 6:160943998-160944020 GAAACCAAAATTAAAATGAAAGG + Intergenic
1024720049 7:52126145-52126167 GCTTCCAACATTAAGATGTAAGG - Intergenic
1027748762 7:82113909-82113931 GATGCCAATATTAAGATGAATGG + Intronic
1028281086 7:88928675-88928697 CATGCCAATTTTAATTTGAAGGG - Intronic
1028379405 7:90182126-90182148 GATAACAATATTAAGAACAATGG - Intronic
1030293419 7:107894502-107894524 AATGCTAATATGATGATGAAGGG + Intronic
1031266105 7:119583325-119583347 GATGCCAATTTTGAGGTAAAGGG - Intergenic
1032296252 7:130641397-130641419 AATACCAATATTTAGATGACAGG + Intronic
1033432545 7:141302187-141302209 AATGCAAAGATTCAGATGAACGG + Intronic
1035947083 8:3977091-3977113 AATGCAGAAATTAAGATGAAAGG - Intronic
1036633798 8:10533691-10533713 GTGGCCACTTTTAAGATGAAGGG - Intronic
1038487168 8:27944489-27944511 GTTAACAATATTAAAATGAAGGG + Intronic
1038882981 8:31635302-31635324 GGGGGAAATATTAAGATGAAAGG - Intergenic
1039703351 8:39983362-39983384 GCTGCAAAAATTAAGGTGAAAGG - Intronic
1040862839 8:52017977-52017999 GATGCCAAGAATAAAAGGAAAGG - Intergenic
1041753259 8:61284783-61284805 TATGCCAAGAATAAGATTAAGGG + Intronic
1044509049 8:93054300-93054322 GCTTCCAATATTATGTTGAATGG + Intergenic
1044900048 8:96934603-96934625 GTTGCTCACATTAAGATGAATGG - Intronic
1045230575 8:100302674-100302696 CATCCCAACATTAAGATGTAGGG + Intronic
1045842159 8:106593187-106593209 GATCCCAATCTTGAGATCAAGGG + Intronic
1046394788 8:113627278-113627300 AATGTTAATATTAAGATGTAAGG - Intergenic
1052230463 9:26144749-26144771 GATGCAAAAATTAATATGATGGG - Intergenic
1055850952 9:80629357-80629379 GATGTCAATTTTGAGATGACTGG + Intergenic
1057380981 9:94567355-94567377 GATGTCAAGATTAAGAAGAAAGG - Exonic
1057723225 9:97549346-97549368 CATGCCACTAGTAAGATGAAGGG + Intronic
1058201748 9:102050953-102050975 GATGCTAAAATTAAAATGATTGG - Intergenic
1058495670 9:105556681-105556703 GATGATAAAATTAAGGTGAAAGG - Intergenic
1058996200 9:110300954-110300976 GATGCCAAAGTTAAGACTAAAGG - Intergenic
1060363087 9:122979803-122979825 GAGGCAAATATAAAGATCAATGG - Intronic
1186394661 X:9195676-9195698 CCTGCCAATATAAAGAAGAATGG - Intergenic
1187404238 X:18988214-18988236 GGTGCCAATATTAGGAGGCAAGG - Intergenic
1188827553 X:34854690-34854712 TTTGCCAATATCAAAATGAATGG + Intergenic
1191730305 X:64326971-64326993 GATGCCCATATGCAGAAGAATGG + Intronic
1192785330 X:74329131-74329153 GAGGCCAAGAATAAGCTGAATGG + Intergenic
1193827687 X:86246179-86246201 GATGCCAATGTTCATATGATTGG - Intronic
1195501291 X:105602559-105602581 GATGTGAATATTCAGATCAAGGG + Intronic
1196341086 X:114598496-114598518 GATGCCAATAGAAATATGTAAGG + Intronic
1197111300 X:122778317-122778339 GATGGCAATTCTAAGATGAATGG + Intergenic
1197637681 X:128933590-128933612 GATGACAATATTGAGATCAAGGG - Intergenic
1198473541 X:136973316-136973338 ACTGCCAGTATTAAGAGGAATGG - Intergenic