ID: 1027751995

View in Genome Browser
Species Human (GRCh38)
Location 7:82161025-82161047
Sequence ACAAGGTGCCCTGTTTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 297}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027751995_1027751999 2 Left 1027751995 7:82161025-82161047 CCCAAAGAAACAGGGCACCTTGT 0: 1
1: 0
2: 3
3: 41
4: 297
Right 1027751999 7:82161050-82161072 ATTTTTTATGCTAGGTTTGATGG 0: 1
1: 2
2: 3
3: 48
4: 446
1027751995_1027752001 20 Left 1027751995 7:82161025-82161047 CCCAAAGAAACAGGGCACCTTGT 0: 1
1: 0
2: 3
3: 41
4: 297
Right 1027752001 7:82161068-82161090 GATGGGCAAGTAGATAGTTGTGG No data
1027751995_1027751998 -6 Left 1027751995 7:82161025-82161047 CCCAAAGAAACAGGGCACCTTGT 0: 1
1: 0
2: 3
3: 41
4: 297
Right 1027751998 7:82161042-82161064 CCTTGTGTATTTTTTATGCTAGG No data
1027751995_1027752000 3 Left 1027751995 7:82161025-82161047 CCCAAAGAAACAGGGCACCTTGT 0: 1
1: 0
2: 3
3: 41
4: 297
Right 1027752000 7:82161051-82161073 TTTTTTATGCTAGGTTTGATGGG 0: 1
1: 0
2: 2
3: 17
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027751995 Original CRISPR ACAAGGTGCCCTGTTTCTTT GGG (reversed) Intronic
900812672 1:4819658-4819680 TCAAGGTGGCCTTTTTCTTATGG + Intergenic
901857485 1:12053605-12053627 ACAAGGTGGGCTGCTGCTTTGGG + Intergenic
902594708 1:17501362-17501384 GGAAGTTTCCCTGTTTCTTTTGG + Intergenic
905480213 1:38256650-38256672 ACAAGGTTCCATTTTTTTTTTGG + Intergenic
907232431 1:53012375-53012397 ACAACTTCCCCTGTATCTTTGGG + Intronic
907316986 1:53578612-53578634 ACAAGTTGCCCTCTTTGCTTTGG + Intronic
908341515 1:63185055-63185077 ACAGGTTTCCTTGTTTCTTTGGG - Intergenic
908844037 1:68306550-68306572 ACAGATTTCCCTGTTTCTTTGGG - Intergenic
908895146 1:68889894-68889916 AGAATGTTCCCTGCTTCTTTTGG - Intergenic
909436254 1:75646464-75646486 ACAGGCTTCCCTATTTCTTTGGG - Intergenic
909490266 1:76218509-76218531 ACATGTTGCATTGTTTCTTTAGG - Intronic
910276059 1:85450107-85450129 ACAAGTTGCGTTTTTTCTTTAGG + Intronic
911516548 1:98874785-98874807 ACAAATTTCCCTGTTTCTTTGGG + Intergenic
911771176 1:101744367-101744389 ACAATTTCCCCTGTATCTTTGGG + Intergenic
913169569 1:116220178-116220200 ACAAGGTCCCCTGTTAACTTTGG - Intergenic
913503579 1:119495201-119495223 ACAAGCTGCCTTCTTTCCTTGGG - Intergenic
918240036 1:182612859-182612881 ACAATTTCCCCTGTGTCTTTGGG - Intergenic
921053495 1:211527271-211527293 ACAGGGTCCCCTGATCCTTTAGG + Intergenic
921234042 1:213106407-213106429 AAAAACTGCCATGTTTCTTTTGG - Intronic
922034886 1:221838756-221838778 ACAAGCTTCTCTCTTTCTTTGGG - Intergenic
922945958 1:229514181-229514203 ACAAGTTTCCTTGTTTGTTTGGG + Intergenic
923698440 1:236278025-236278047 TCATGGTGCCCTGTTTCCTTGGG + Intronic
1063732313 10:8711573-8711595 CCACGGTGCCCGGCTTCTTTTGG + Intergenic
1063851803 10:10200704-10200726 ACAGGTTTTCCTGTTTCTTTGGG + Intergenic
1064627929 10:17280665-17280687 ACAAGGTACCCTGCTTCTTCTGG + Intergenic
1065264371 10:23959625-23959647 ACAAGTTTCCCTGTTTCTTTGGG - Intronic
1068645016 10:59456473-59456495 ACAAGCTGACCTGTTATTTTTGG - Intergenic
1070066690 10:73041792-73041814 ACAGGTTTCCCTGTTTCTTTGGG + Intronic
1070336581 10:75461155-75461177 ACAGGTTTACCTGTTTCTTTGGG - Intronic
1070542947 10:77430086-77430108 ACAAAGTTCACTCTTTCTTTTGG - Intronic
1070646809 10:78207432-78207454 ACAAGGAGCCATGTCCCTTTCGG + Intergenic
1073692121 10:105820695-105820717 ACAGAATGCCCTTTTTCTTTGGG - Intergenic
1074539497 10:114352827-114352849 ACAAGGGGCAATGTTCCTTTCGG + Intronic
1075052576 10:119193755-119193777 ACGGGGTTCCCTGTTCCTTTGGG + Intergenic
1076620273 10:131782778-131782800 ACCATGTGCACTGCTTCTTTGGG + Intergenic
1077882648 11:6363470-6363492 ACAAGGGGCCCTGATTCCTGAGG - Intergenic
1079365980 11:19810372-19810394 CCAAGGATCCCTGGTTCTTTTGG + Intronic
1080756043 11:35200048-35200070 ACATGATGCCCTCTTTCTTCTGG + Intronic
1084523344 11:69679562-69679584 ACAGGGTGAACTGTTTTTTTTGG - Intergenic
1084625868 11:70306114-70306136 GCAAAGTGACCTTTTTCTTTTGG + Intronic
1086279316 11:85167700-85167722 ACAGGTTTCCCTTTTTCTTTAGG + Intronic
1087020377 11:93596538-93596560 ACAATTTCCCCTGTATCTTTGGG + Intergenic
1087965707 11:104411555-104411577 TCATGGTGACTTGTTTCTTTAGG - Intergenic
1089369276 11:117942733-117942755 ACAACTTCCCCTGTATCTTTGGG + Intergenic
1090467074 11:126944219-126944241 ACAGGTTTCCCTGTATCTTTGGG + Intronic
1090472281 11:126990720-126990742 ACAAGGAGTTCTGTTTCTTCAGG - Intronic
1091191028 11:133695378-133695400 ACAAGGTCCTCAGTTTCTCTGGG + Intergenic
1092084132 12:5741821-5741843 CCAAGGTGCCCTGTTACCTTGGG - Intronic
1093798902 12:23347725-23347747 CCAAGTTTACCTGTTTCTTTGGG - Intergenic
1094702598 12:32884472-32884494 ACAGTCTTCCCTGTTTCTTTGGG + Intronic
1094838571 12:34333608-34333630 TCAAGCAGCCCTGTTGCTTTAGG - Intergenic
1095710588 12:45284072-45284094 ACAATTTCCCCTGTATCTTTGGG - Intronic
1096287138 12:50309981-50310003 ACAATTTTCCCTGTTTCTTTGGG - Intergenic
1096676692 12:53230149-53230171 CCCAGGTGCCTTGGTTCTTTGGG + Intronic
1097689808 12:62724177-62724199 ACAGTTTGCCCTGTTTCCTTGGG + Intronic
1098185530 12:67892356-67892378 ACAAGGTGACCTGTCTCAGTGGG + Intergenic
1098284900 12:68896994-68897016 ACAAGCTGTTCTGTTTCTCTGGG - Intronic
1099111624 12:78569100-78569122 ACAATTTGTCCTGTATCTTTAGG - Intergenic
1100027566 12:90148510-90148532 CCAGGTTTCCCTGTTTCTTTGGG + Intergenic
1100071019 12:90717881-90717903 ACAAGGTGTCTTTTTTCCTTTGG + Intergenic
1100373394 12:93990473-93990495 ACAATTTTCCTTGTTTCTTTGGG - Intergenic
1102397894 12:112602963-112602985 ACAGATTTCCCTGTTTCTTTGGG - Intronic
1102478170 12:113202225-113202247 ACAAGGTCCCCCTTTTCTTGTGG + Intronic
1102595048 12:113985931-113985953 AAAAAGTGCCATTTTTCTTTGGG + Intergenic
1103678914 12:122677942-122677964 ACAATTTCCCCTGTGTCTTTTGG + Intergenic
1105804218 13:23940694-23940716 ACAAGGTGCTCTTTAGCTTTGGG - Intergenic
1106113014 13:26793357-26793379 ACAGGTTTCCCTGTGTCTTTGGG + Intergenic
1106925117 13:34605699-34605721 ACAAGTTGACCTGTTTCTTTGGG + Intergenic
1107934151 13:45330717-45330739 ACAAGCTCACCTGTTTCTTTGGG + Intergenic
1108076571 13:46686225-46686247 ACAATTTCCCCTGTATCTTTGGG - Intronic
1108950284 13:56083958-56083980 ACAGGTTCTCCTGTTTCTTTGGG + Intergenic
1109595527 13:64548930-64548952 ACAGTTTTCCCTGTTTCTTTGGG + Intergenic
1110601137 13:77375389-77375411 GCAGGTTTCCCTGTTTCTTTGGG + Intergenic
1110623861 13:77629720-77629742 ACAATTTCCCCTGTATCTTTGGG - Intronic
1111046221 13:82816138-82816160 ACAATTTCCCCTGTATCTTTAGG + Intergenic
1111344348 13:86929833-86929855 AGAAAGTGCTTTGTTTCTTTTGG - Intergenic
1112462214 13:99613195-99613217 CCAGGGAGCCCTTTTTCTTTTGG - Intronic
1113191690 13:107755822-107755844 ACCAGGAGCCCTGTTACTTCAGG + Intronic
1113484394 13:110643617-110643639 ACAAGGCGCTCTGGCTCTTTTGG - Intronic
1113526443 13:110981698-110981720 ACATGTTTCCCTATTTCTTTGGG + Intergenic
1113832332 13:113305996-113306018 ACCTGGTGCCCTGTCCCTTTCGG - Intronic
1115165139 14:30439603-30439625 ACCGGGTTTCCTGTTTCTTTGGG + Intergenic
1116636586 14:47404016-47404038 TCATGTTTCCCTGTTTCTTTGGG + Intronic
1116666087 14:47777469-47777491 ACAGTTTTCCCTGTTTCTTTGGG + Intergenic
1117378887 14:55140224-55140246 ATAAGGAGTCATGTTTCTTTGGG - Intronic
1117416563 14:55501869-55501891 ATACGTTTCCCTGTTTCTTTAGG - Intergenic
1117714639 14:58567918-58567940 ACTAGGTGCTCTGCTTCTTTAGG - Intergenic
1117836142 14:59808225-59808247 TCAAGGTGGTCTTTTTCTTTAGG - Intronic
1118757432 14:68855054-68855076 ACAAATTTCCCTGTTTCTTTGGG - Intergenic
1118882287 14:69840116-69840138 CCAAGGAGCCCTGGTTCCTTTGG + Intergenic
1119752236 14:77087726-77087748 ACAATTTTCCCTGTATCTTTGGG - Intergenic
1119864637 14:77963105-77963127 ACAATTTCCCCTGTATCTTTGGG + Intergenic
1119961642 14:78864703-78864725 ACAGGATTCCCTGTTTCTTTGGG - Intronic
1120356798 14:83444449-83444471 ACAGATTTCCCTGTTTCTTTAGG + Intergenic
1120534373 14:85675653-85675675 ACAAAGTGCCTTGCTACTTTTGG - Intergenic
1121506447 14:94481425-94481447 CCAAGGTGCCCTTTCTCTTTGGG - Intergenic
1122141380 14:99664879-99664901 ACAATTTCCCCTGTATCTTTGGG - Intronic
1122188610 14:100021927-100021949 ACCAAGTTCTCTGTTTCTTTGGG + Intronic
1124126750 15:26943974-26943996 CCAAGCTGCACTGTTTCCTTGGG + Intronic
1124591920 15:31061265-31061287 ACAAGGCTCGCTGTTTCTGTGGG - Intronic
1124842574 15:33257338-33257360 ACAAGGAGGCCTGGTTCTCTTGG + Intergenic
1124902688 15:33838835-33838857 TTAAGCTGCCCTCTTTCTTTGGG - Exonic
1125859143 15:42981346-42981368 CAAATGTGCCCTGTGTCTTTTGG + Intronic
1125887607 15:43240394-43240416 ACAATTTCCCCTGTATCTTTGGG + Intronic
1126730713 15:51679786-51679808 ACAAAATACCCTTTTTCTTTTGG + Intergenic
1127332667 15:57954141-57954163 ATAATGTGCCCTGTATCTATTGG - Exonic
1127376807 15:58392615-58392637 ACAATTTCCCCTGTATCTTTGGG - Intronic
1128733216 15:70034655-70034677 AACAGGTGCCCTGTTTCCTGCGG - Intergenic
1130351191 15:83093200-83093222 CCAAGTTTCCTTGTTTCTTTGGG + Intergenic
1130528356 15:84726152-84726174 ACTAGGTGCACAGATTCTTTTGG - Intergenic
1130556627 15:84927337-84927359 ACAATTTTCCCTGTATCTTTGGG - Intronic
1134841448 16:17405214-17405236 ACATGATGCCCTGTTTCTCCTGG + Intronic
1135148263 16:19982672-19982694 ATAGGTTTCCCTGTTTCTTTGGG - Intergenic
1135697673 16:24604406-24604428 ACAAGCTTCCGTGTTTCTCTGGG + Intergenic
1136188025 16:28599516-28599538 AGAAGCTGCCCTGGTTCTTCCGG + Intergenic
1136190497 16:28612510-28612532 AGAAGCTGCCCTGGTTCTTCCGG + Intronic
1137381333 16:48002401-48002423 ACAATTTCCCCTGTATCTTTGGG - Intergenic
1139314132 16:66053816-66053838 ACAGGCTTCCCTGTTTCTTTGGG - Intergenic
1140292142 16:73669487-73669509 ACAAGCTTCCCTGAGTCTTTTGG - Intergenic
1140526295 16:75625694-75625716 ACCTGGTGCCATATTTCTTTGGG + Intergenic
1141257184 16:82413477-82413499 AAAAAATGCCCTTTTTCTTTTGG - Intergenic
1141495813 16:84408660-84408682 TCAAGGTGCCCTGGTTTATTCGG + Intronic
1141636306 16:85315776-85315798 ACAGGGTGCCCAGTTCATTTCGG - Intergenic
1142407306 16:89897683-89897705 ACATGGAGCCCTGTGACTTTCGG - Intronic
1144219223 17:13084861-13084883 ACAAGTTTAACTGTTTCTTTGGG - Intergenic
1146075642 17:29726036-29726058 ACAAGGTGCACTGCTGTTTTAGG + Intronic
1146649986 17:34600748-34600770 GCAAGGTGCCCTGCTGCTCTGGG - Intronic
1147044560 17:37743443-37743465 ACAAGTTCCCCTGATTGTTTTGG + Intronic
1147685666 17:42285590-42285612 ACAAAGTGCCCTGGTGATTTTGG - Intergenic
1147943278 17:44065612-44065634 AAAAGGTGGCCTGCTTCTTTGGG - Intronic
1149273442 17:55008573-55008595 ACAGTTTTCCCTGTTTCTTTGGG - Intronic
1149601224 17:57894173-57894195 ACCAGGTGTCCTGCTTCTCTGGG - Intronic
1150598705 17:66630732-66630754 ACAAGGTGGACGGTTTCATTGGG + Intronic
1151741055 17:75982305-75982327 ACAATTTCCCCTGTATCTTTGGG + Intronic
1152015565 17:77748300-77748322 ACAATTTCCCCTGTATCTTTTGG + Intergenic
1153504501 18:5781890-5781912 ACAATTTCCCCTGTATCTTTGGG - Intergenic
1154000214 18:10476235-10476257 ACACGGTGTCCTGTTTCTAGAGG - Intronic
1155938263 18:31776792-31776814 AGAAACTTCCCTGTTTCTTTGGG + Intergenic
1155941144 18:31803474-31803496 ACAAGGTTCCCTTGTTCTTTGGG + Intergenic
1156989901 18:43396694-43396716 ACATATTCCCCTGTTTCTTTAGG - Intergenic
1157418078 18:47522622-47522644 ACAGGTTTCCTTGTTTCTTTGGG + Intergenic
1160214155 18:76912294-76912316 ACAAGGTTCCCAGTTTCTGGAGG + Exonic
1160689389 19:454352-454374 ACAGGGTCCCCTGTCTCTGTGGG - Intronic
1163060182 19:14755089-14755111 AGAAGGTGCTCTGTGTCTTCTGG - Exonic
1163820875 19:19495971-19495993 GCAAGGTGCCCTGTGCCTTCCGG + Intronic
1167304457 19:48699163-48699185 CCAGGTTTCCCTGTTTCTTTAGG - Intronic
1168488440 19:56785992-56786014 AGAAGGTGCAGGGTTTCTTTTGG - Intronic
927280228 2:21298470-21298492 ACATGTTGCCCTGTGGCTTTGGG + Intergenic
928319768 2:30273834-30273856 ACAAGGTGCAGTGTTTCCGTGGG - Intronic
928620164 2:33081006-33081028 AGAGGTTTCCCTGTTTCTTTGGG - Intronic
929123567 2:38502962-38502984 ACAATTTCCCCTGTATCTTTGGG + Intergenic
929324931 2:40598388-40598410 ACAAGGAGGCCGTTTTCTTTTGG - Intronic
930105440 2:47635435-47635457 ACAGGTTTTCCTGTTTCTTTGGG - Intergenic
930370414 2:50494309-50494331 AAAAAGTGCCCTGTTTGTGTAGG - Intronic
930999313 2:57761671-57761693 ACAAGTTTACCTGTTTCTCTGGG + Intergenic
931035929 2:58242718-58242740 ACAGGTTTTCCTGTTTCTTTGGG + Intergenic
931062323 2:58545216-58545238 ACAAGTTTAACTGTTTCTTTGGG - Intergenic
931163389 2:59718690-59718712 ACAATTTCCCCTGTTTCTTTGGG + Intergenic
936982587 2:118277946-118277968 ACAATTTCCCCTGTATCTTTGGG + Intergenic
940235546 2:151507639-151507661 ACATATTTCCCTGTTTCTTTGGG + Intronic
940361225 2:152798312-152798334 TCAAGGTGGTCTTTTTCTTTTGG + Intergenic
940427033 2:153541833-153541855 ACAATTTCCCCTGTATCTTTGGG + Intergenic
941748629 2:169112595-169112617 ACATGTTTCCTTGTTTCTTTGGG + Intergenic
941877268 2:170446856-170446878 ACAGATTTCCCTGTTTCTTTGGG - Intronic
942370688 2:175281028-175281050 ACAGGTTTCCCTGTTTCTTTGGG - Intergenic
944618798 2:201490558-201490580 AAAAGGTGCCCTCTTCCTCTGGG - Intronic
945000496 2:205345196-205345218 ATAAGGTTCCTTGTTTTTTTTGG - Intronic
945582210 2:211609490-211609512 ACAATTTTCCCTGTATCTTTGGG + Intronic
945933294 2:215878047-215878069 ACAGATTTCCCTGTTTCTTTGGG + Intergenic
948092247 2:235303960-235303982 AAAATGTTCCCTTTTTCTTTTGG - Intergenic
1169460110 20:5787037-5787059 ACAATTTCCCCTGTATCTTTGGG + Intronic
1170341289 20:15330113-15330135 ACAAGCTAATCTGTTTCTTTGGG + Intronic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1173138920 20:40464993-40465015 CCATGGTTCCCTGTTTTTTTTGG + Intergenic
1173387108 20:42599046-42599068 ACAAGATGCCCTGGTTTATTAGG + Intronic
1173595638 20:44257223-44257245 ACAAGGAGCCCTGGTTCATGCGG + Exonic
1173809909 20:45949341-45949363 ACAAGGAGCCCCGTTCCTTCAGG - Exonic
1176998857 21:15587420-15587442 ACGAGTTTCCCTGTTTCTTGGGG + Intergenic
1177068404 21:16469035-16469057 ACACTGAGCCCTTTTTCTTTTGG - Intergenic
1177685062 21:24425134-24425156 AAAAGTTGCCCTGTTGATTTGGG + Intergenic
1179448838 21:41453769-41453791 TCAAGGTGTCCTGCCTCTTTAGG - Intronic
1182508051 22:30799527-30799549 GCAAGTTGCCCTTTGTCTTTGGG - Intronic
1184124930 22:42480347-42480369 ACAATTTCCCCTGTATCTTTGGG + Intergenic
1184133135 22:42529760-42529782 ACAATTTCCCCTGTATCTTTGGG + Intergenic
1185156992 22:49199102-49199124 TCAAGGGGACCTGTCTCTTTGGG - Intergenic
949152095 3:781570-781592 AACAGGTTTCCTGTTTCTTTAGG + Intergenic
949748211 3:7320330-7320352 ACAGGTTTCCCTTTTTCTTTTGG - Intronic
951688968 3:25375478-25375500 GCAAGGTGATCAGTTTCTTTTGG + Intronic
952162742 3:30710654-30710676 ATAGGTTTCCCTGTTTCTTTAGG - Intergenic
953010956 3:39024891-39024913 ACAATTTCCCCTGTATCTTTGGG + Intergenic
953857888 3:46515163-46515185 ACAAATTTACCTGTTTCTTTGGG + Intergenic
954651337 3:52165363-52165385 ACAAGGTGCCAGTTTTCCTTAGG - Intergenic
955489009 3:59463834-59463856 ACAATTTTCTCTGTTTCTTTGGG + Intergenic
955579504 3:60403798-60403820 ACAATTTCCCCTGTATCTTTGGG + Intronic
955674200 3:61433546-61433568 ACAAGGTGCTCTGGTTAATTAGG - Intergenic
957297381 3:78350473-78350495 ACAGGTTTCCCTATTTCTTTGGG - Intergenic
957315777 3:78574918-78574940 ACAAATTTCCCTGTTTCTTTGGG - Intergenic
957413470 3:79870408-79870430 ACCAGGTGGCCTGTCTCTTCAGG - Intergenic
957509526 3:81169569-81169591 AAAAGTTTCACTGTTTCTTTGGG - Intergenic
957885180 3:86278460-86278482 ACAAGTTTCTCTGTTTCTTTGGG + Intergenic
957986966 3:87584394-87584416 ACAAAGTGCCGTATTTCCTTTGG - Intergenic
958911727 3:100001686-100001708 GCAATGTGTACTGTTTCTTTTGG - Intronic
959175272 3:102901369-102901391 ACAGGTTTCCCTGTTTATTTGGG - Intergenic
959847335 3:111049297-111049319 ACAGTTTTCCCTGTTTCTTTGGG - Intergenic
960251606 3:115461583-115461605 ACAATTTCCCCTGTATCTTTAGG + Intergenic
961337794 3:126193582-126193604 TCATGGTCCCATGTTTCTTTCGG + Intronic
963019417 3:140858371-140858393 ACAGGGTACAGTGTTTCTTTGGG + Intergenic
963067761 3:141277520-141277542 AAGAGGTGCTCTTTTTCTTTCGG - Intronic
964780295 3:160329741-160329763 ACAGGTTTCCCTGTTTCTTGGGG + Intronic
964876498 3:161373145-161373167 AGCAGGTGCTCTGTTTCTATTGG - Intergenic
966365859 3:179186647-179186669 ACAATGAGCCCTATTTTTTTTGG + Intronic
967481138 3:189974685-189974707 ACAATGTGCTCTGTTCCTGTAGG - Exonic
974467174 4:62272219-62272241 ACAATTTCCCCTGTGTCTTTGGG + Intergenic
974832157 4:67202676-67202698 ACAGGTTTCCCTGTTTCTTTGGG + Intergenic
974845261 4:67344280-67344302 ACGGGTTTCCCTGTTTCTTTGGG - Intergenic
974845368 4:67345411-67345433 ACAGGTTTTCCTGTTTCTTTGGG - Intergenic
975572158 4:75828598-75828620 ACACTGTCCCCTGTATCTTTGGG + Intergenic
975582903 4:75922628-75922650 ACAATGTCCCCTGTATCTTTGGG + Intronic
976407055 4:84672049-84672071 AAAAGGGGCCCTGTTTATGTAGG + Exonic
977316019 4:95448907-95448929 TCTAGGTGCCCCTTTTCTTTGGG + Intronic
978552964 4:109947901-109947923 AAAAGGTGCTCTATTTCTTCAGG - Intronic
978564655 4:110069211-110069233 ACCAGGTGTTCTGTTTCTTTTGG - Intronic
978808542 4:112825726-112825748 ACAAATTTACCTGTTTCTTTGGG - Intronic
979186905 4:117808068-117808090 ACACTTTGCCCTGTATCTTTGGG + Intergenic
980526768 4:133999161-133999183 ACAGGTTTCCCTGTTTCTTTGGG + Intergenic
980689637 4:136278789-136278811 TCAAGCTTCCCTGTTTGTTTGGG - Intergenic
980745776 4:137013158-137013180 ACAAGGTGCTGTGTCTCTTTGGG - Intergenic
980787826 4:137577707-137577729 ACAAGGTGACTTGTGTGTTTTGG - Intergenic
981868421 4:149456140-149456162 ACAAATTTTCCTGTTTCTTTGGG - Intergenic
981921281 4:150087556-150087578 ACAACTTCCCCTGTATCTTTGGG - Intronic
983147735 4:164238976-164238998 TCAAGGTTCACAGTTTCTTTGGG + Intronic
983461476 4:168029625-168029647 ACAATGAGACCTTTTTCTTTTGG - Intergenic
984657123 4:182330259-182330281 ACAAGTTTACCTGTTTCTTTGGG - Intronic
985104926 4:186490798-186490820 ACAGTGTTCCCTGTTTCTTTGGG - Intronic
985429745 4:189867760-189867782 ACAAGATTTCCTGTTTCTTTGGG - Intergenic
985979240 5:3448646-3448668 ACAAGGTGCATTTTTTTTTTAGG + Intergenic
986415026 5:7519767-7519789 ACTAGGTGCACGGTTTCCTTCGG - Intronic
986685379 5:10271534-10271556 ACAATTTCCCCTGTGTCTTTGGG + Intergenic
986775871 5:11013274-11013296 ACAAGTTTACCTGTTTCTTTGGG + Intronic
987283424 5:16434427-16434449 ACAAAGGGCTTTGTTTCTTTGGG - Intergenic
989427143 5:41309061-41309083 ACAATGTGCCCTTTTTCTTTAGG + Exonic
989558312 5:42822469-42822491 ACAATTTCCCCTGTATCTTTGGG + Intronic
990225724 5:53650419-53650441 ACAGATTTCCCTGTTTCTTTGGG - Intronic
990227676 5:53674132-53674154 ACAAGTATTCCTGTTTCTTTGGG - Intronic
990420967 5:55632921-55632943 ACAATTTCCCCTGTATCTTTGGG + Intronic
991325703 5:65429356-65429378 ACAGTTTTCCCTGTTTCTTTGGG + Intronic
992220989 5:74573222-74573244 ACAGGTTTCCCTGCTTCTTTGGG + Intergenic
992962488 5:81970235-81970257 ACAATTTCCCCTGTATCTTTGGG + Intergenic
993474482 5:88347505-88347527 TCAAGTTGCCCTGTTCTTTTGGG - Intergenic
993882413 5:93378853-93378875 TTCAGGTGCCCTGATTCTTTGGG + Intergenic
994201018 5:96976009-96976031 AGAAAATTCCCTGTTTCTTTAGG + Intronic
994250761 5:97534090-97534112 ACCAGGTGCCCCTTTTCTGTGGG + Intergenic
994910312 5:105896934-105896956 ACAAGCTACCTTGCTTCTTTTGG + Intergenic
995085971 5:108109516-108109538 ACAGGTTTACCTGTTTCTTTAGG + Intronic
998108685 5:139484743-139484765 ACAATTTGCCCTCTGTCTTTGGG + Intergenic
998900416 5:146847378-146847400 TAAAGGTGCCATGCTTCTTTTGG + Intronic
998990825 5:147814073-147814095 ACAAGTTTACCTGTTTCTTTGGG + Intergenic
999966729 5:156818473-156818495 ACAATTTCCCCTGTATCTTTGGG + Intergenic
1000864255 5:166493078-166493100 ACAGATTTCCCTGTTTCTTTGGG - Intergenic
1002972742 6:2040904-2040926 ACAGGTTTCCCTGTTTCTTTGGG + Intronic
1004149318 6:13100217-13100239 ACAAGTTTACCTGTTTCTTGGGG - Intronic
1004442781 6:15669892-15669914 ACAAGATTACCTGTTCCTTTGGG + Intergenic
1004904271 6:20221753-20221775 ACAGGTTTCCCTGTGTCTTTGGG + Intergenic
1005577517 6:27203889-27203911 AAATGTTTCCCTGTTTCTTTAGG - Intergenic
1005643781 6:27822118-27822140 ACAATTTCCCCTGTATCTTTAGG - Intergenic
1005652592 6:27898152-27898174 ACAATTTCCCCTGTATCTTTAGG + Intergenic
1007595286 6:43047319-43047341 ACAAGATGCCCTGCTACTCTAGG + Intronic
1008982368 6:57499624-57499646 ACACGTTTCCCTTTTTCTTTCGG + Intronic
1009170434 6:60392460-60392482 ACATGTTTCCCTGTTTCTTTGGG + Intergenic
1009551689 6:65103654-65103676 ACAAAGTTCACTGCTTCTTTAGG + Intronic
1011421287 6:87176236-87176258 ACAGGTTTCCCTGTATCTTTGGG - Intronic
1011507288 6:88059747-88059769 ACAAGTTGCCCTGTTGCTGCTGG + Intronic
1011726578 6:90215878-90215900 GGAAGGTGACCTGTTTCCTTGGG - Intronic
1013753818 6:113437749-113437771 ACAGATTTCCCTGTTTCTTTGGG - Intergenic
1014772809 6:125476145-125476167 ACAGGTTTCCCTGTTTCTTTGGG - Intergenic
1014860965 6:126468097-126468119 ACTAGTTGCCCTATCTCTTTAGG - Intergenic
1015042663 6:128740852-128740874 ACAGGTTTCCCTGTTTCTTCAGG - Intergenic
1015265981 6:131292965-131292987 ACAGGTTTCCCTGTTTCTTTGGG - Intergenic
1019822339 7:3254488-3254510 ACAATTTTCCCTGTATCTTTAGG - Intergenic
1019958318 7:4435160-4435182 ACATGGCCCCCTGATTCTTTGGG + Intergenic
1020680733 7:11233614-11233636 ACAGGTTGTCCTGATTCTTTGGG + Intergenic
1021152661 7:17169975-17169997 ATACGTTTCCCTGTTTCTTTGGG + Intergenic
1021901141 7:25287020-25287042 ACAGGTTTCCCTATTTCTTTGGG - Intergenic
1024295003 7:47834612-47834634 TCAAGCTGCCATGTTTCCTTAGG - Intronic
1026319597 7:69257230-69257252 ATAAAGTACCCTGTGTCTTTAGG - Intergenic
1027751995 7:82161025-82161047 ACAAGGTGCCCTGTTTCTTTGGG - Intronic
1029232579 7:99083240-99083262 ACAAGGTTCTCTCTTTCATTTGG - Intronic
1029586412 7:101474812-101474834 ACAGGTCTCCCTGTTTCTTTGGG - Intronic
1030624780 7:111832384-111832406 ACAAGATACCCTGTTCCTGTAGG - Intronic
1030878123 7:114841605-114841627 ACAAGTTTCCCTTTATCTTTGGG - Intergenic
1031172765 7:118312658-118312680 ACAATTTCCCCTGTATCTTTGGG - Intergenic
1031774812 7:125894728-125894750 ACAATTTTTCCTGTTTCTTTGGG + Intergenic
1032672752 7:134100025-134100047 ACAGGTTTCCCTGGTTCTTTGGG + Intergenic
1033468330 7:141618761-141618783 AGGAGGTGCCCTGTTTGGTTAGG + Intronic
1034432190 7:151046609-151046631 ACACGGTGCCCTGTTCCCCTGGG + Intronic
1034851643 7:154499374-154499396 AACAGGAGCCCAGTTTCTTTGGG - Intronic
1034885419 7:154794815-154794837 ACAAGGTGACCTGCTTCTGGGGG - Intronic
1035201733 7:157272062-157272084 AGGACGTGGCCTGTTTCTTTGGG + Intergenic
1036007774 8:4686647-4686669 ACAAGTTGACCTGTTGCTCTGGG + Intronic
1038071452 8:24018599-24018621 ACAAGTTGCCTAGTTTCTCTGGG + Intergenic
1038265640 8:26037992-26038014 ATCAGGTGCCCTGTTTCTCAAGG - Intronic
1039184428 8:34900754-34900776 ACAGAATTCCCTGTTTCTTTGGG + Intergenic
1039328352 8:36509637-36509659 ACAATCTCCCCTGTATCTTTGGG + Intergenic
1039569513 8:38575800-38575822 ACAATATCCCCTGTATCTTTGGG + Intergenic
1040447317 8:47508553-47508575 AAAAGATGCCGTGTTGCTTTCGG + Intronic
1040490637 8:47918563-47918585 CCAAGGAGCCATGTTCCTTTTGG - Intronic
1040761229 8:50847455-50847477 ACAAGGTATCCTTTCTCTTTCGG + Intergenic
1041529127 8:58842716-58842738 ACAAGTTCTCCTGTTTCTTCAGG - Intronic
1042013858 8:64284659-64284681 ACAGTTTTCCCTGTTTCTTTGGG + Intergenic
1042646919 8:70997335-70997357 ACAAGTTTACCTGTTTCTTTGGG + Intergenic
1046263730 8:111804218-111804240 ACAAGTTTCCATGTCTCTTTGGG + Intergenic
1046790697 8:118318813-118318835 ACAAGGTGACATGTGTCTTTAGG + Intronic
1046943420 8:119953221-119953243 ACAATTTCCCCTGTATCTTTGGG - Intronic
1047176958 8:122550943-122550965 AGAAGGTGCTCTGTCTCTATAGG + Intergenic
1047324152 8:123820254-123820276 AAAAAGTGGCCTTTTTCTTTTGG - Intergenic
1048502332 8:134989513-134989535 ACAGGGCTCCCTGTTGCTTTAGG + Intergenic
1049983088 9:922678-922700 AAATGGTGCCTTATTTCTTTTGG + Intronic
1050191883 9:3034941-3034963 GGAAGGTCACCTGTTTCTTTTGG + Intergenic
1050496712 9:6250543-6250565 AAAAGGAGGCCTGTTACTTTAGG + Exonic
1051213762 9:14774436-14774458 CCAACGTGCCCTGTGTATTTCGG + Intronic
1051755190 9:20392030-20392052 ACAAGGTGAGCTGATTCTTGTGG - Intronic
1054867330 9:70015845-70015867 ATAGGTTTCCCTGTTTCTTTGGG + Intergenic
1055080599 9:72264804-72264826 ACAGGTTTACCTGTTTCTTTGGG - Intergenic
1055965765 9:81863535-81863557 ACAAGGTTCACTATTTATTTTGG + Intergenic
1057023896 9:91721565-91721587 ACAGGCTTCCCTGCTTCTTTGGG + Intronic
1060455324 9:123787770-123787792 AAAAGGTGCCCTTTCTCTTAAGG - Intronic
1186080806 X:5929814-5929836 ACAGGTTTCCCTGTTTCTTTTGG - Intronic
1186218553 X:7325705-7325727 ACAATTTCCCCTGTATCTTTGGG - Intronic
1187842353 X:23501802-23501824 ACAATTTCCCCTGTATCTTTGGG + Intergenic
1188034380 X:25300419-25300441 ACAAGCTTACCTGTTTCTTTGGG + Intergenic
1188369285 X:29349073-29349095 ACAATTTCCCCTGTGTCTTTGGG - Intronic
1194041039 X:88942294-88942316 ACAACTTCCCCTGTGTCTTTGGG - Intergenic
1194721588 X:97346615-97346637 ACAAGTTTCCCTATTTCTTTTGG - Intronic
1194735609 X:97509408-97509430 ACAGGTTTTCCTGTTTCTTTGGG - Intronic
1195565268 X:106332870-106332892 ACAGGTTTCTCTGTTTCTTTGGG - Intergenic
1196306739 X:114111885-114111907 ACAATTTGCCCTGTATCTTTGGG - Intergenic
1196482705 X:116168421-116168443 ACAAGGTCCCCTGTTCCTTGTGG + Intergenic
1198540000 X:137627827-137627849 ACAAGCTTTCCTGTTTCTTTGGG + Intergenic
1198984095 X:142429408-142429430 TCAAGGTGCCCTGCTTTTTTAGG - Intergenic
1199073085 X:143501348-143501370 ACAATTTCCCCTGTATCTTTGGG - Intergenic
1199212675 X:145232491-145232513 ACAAGGGGGCCTCTTGCTTTGGG + Intergenic
1199215642 X:145257408-145257430 ACAATTTCCCCTGTATCTTTGGG + Intergenic