ID: 1027754999

View in Genome Browser
Species Human (GRCh38)
Location 7:82202180-82202202
Sequence CCGTATGTACAGCGTCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 4, 2: 21, 3: 52, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027754999_1027755005 10 Left 1027754999 7:82202180-82202202 CCCTGCTGACGCTGTACATACGG 0: 1
1: 4
2: 21
3: 52
4: 77
Right 1027755005 7:82202213-82202235 GGCGCGTACCCATGACTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027754999 Original CRISPR CCGTATGTACAGCGTCAGCA GGG (reversed) Intronic
904858233 1:33515996-33516018 CCATCTGCACAGCGGCAGCAAGG - Exonic
908445155 1:64192619-64192641 CCATATATACAGCGTTAGCAGGG - Intergenic
908655486 1:66383513-66383535 ATGTATGTACAGTGTTAGCAGGG - Intergenic
909039412 1:70631071-70631093 CCACATGTACAGCATCAGCAGGG - Intergenic
909819996 1:80050428-80050450 CCGTATATACAGCGTTAGCAGGG - Intergenic
910360326 1:86409471-86409493 CCATATGTACAGCGTTAGCAGGG + Intergenic
910361431 1:86416464-86416486 CTGTATATACAGTGTTAGCAAGG + Intergenic
912023610 1:105138710-105138732 CCTCATGTACAGTGTCAGCAGGG - Intergenic
914442447 1:147719289-147719311 CCCCATGCACAGCATCAGCAGGG - Intergenic
917957602 1:180116362-180116384 CCGTATGTACAGCGTGGTCCCGG + Intergenic
918413815 1:184287294-184287316 CCGTATGTACAATGTCAGCAGGG - Intergenic
918414275 1:184290448-184290470 CCATATGTACAACGTCATCAGGG - Intergenic
918720216 1:187842854-187842876 CCATATGTACAGCATTAGCAGGG + Intergenic
919356840 1:196535766-196535788 CCATATGTACAGTGTCAGCATGG + Intronic
924418260 1:243882563-243882585 CCGTATGTACAGTGTCAGCAGGG - Intergenic
924448158 1:244153300-244153322 TTGTATGTACAGCGTCAGGCAGG + Intergenic
1064627125 10:17272899-17272921 CCATATGCACAGTGTCAGCCGGG + Intergenic
1067683663 10:48455086-48455108 CCGCAGGTACAGCTTCAGCAGGG + Exonic
1069735091 10:70648788-70648810 CTGTACATACAGCGTCATCAGGG - Intergenic
1069735581 10:70651949-70651971 CCATATGTACAGCATCAGCAGGG - Intergenic
1070915662 10:80152931-80152953 ACATCTGTACAGCGTCAGCAGGG + Exonic
1074225606 10:111481327-111481349 CTGTATGTACAGCATGAGCAGGG + Intergenic
1079478488 11:20857088-20857110 CTGTATGCACAGCATCAGCAGGG - Intronic
1079995516 11:27291379-27291401 CTGTATGTACAGCAACAGCAGGG + Intergenic
1081049786 11:38324271-38324293 CCCTGTGAACAGCATCAGCAGGG - Intergenic
1085040962 11:73326083-73326105 CTGTATGTGCAGGGTTAGCATGG + Intronic
1085181477 11:74540564-74540586 CCATATGTACAGTGTCAGCTGGG - Intronic
1089405575 11:118194709-118194731 CTGTGTGTACAGCCTCAGAAAGG + Intronic
1092456610 12:8649546-8649568 ACGTATGTACATCGTCAACAAGG - Exonic
1092583418 12:9873059-9873081 GCGCCTGTACAGCATCAGCAGGG + Intergenic
1099126036 12:78759480-78759502 ACATATGTATAGCATCAGCAGGG + Intergenic
1099573539 12:84355823-84355845 CCATATGTACAGTGTTAGCAGGG - Intergenic
1100799070 12:98212456-98212478 CCCTGTGCACAGCGTCAGCAGGG + Intergenic
1104594554 12:130112317-130112339 CCGTCTCTCCAGGGTCAGCAAGG - Intergenic
1107293842 13:38888667-38888689 CAGTATGTCCTGGGTCAGCAGGG + Intergenic
1109388581 13:61665440-61665462 CCCTGTGCACAGTGTCAGCAGGG + Intergenic
1109448853 13:62482494-62482516 CCCTATGCACAGTGTCAGCAGGG + Intergenic
1110131667 13:72018973-72018995 CCATATGTACAGCTTTAGCAGGG - Intergenic
1110613186 13:77511820-77511842 CCATATGTACAATGTTAGCAGGG - Intergenic
1118463610 14:66010755-66010777 GCACATGTACAGTGTCAGCAGGG + Intergenic
1119075127 14:71630200-71630222 CCGTATGTACATTTTCAGGAAGG + Intronic
1129922277 15:79329525-79329547 CTGTATGTGCAATGTCAGCAGGG - Intronic
1131878960 15:96842184-96842206 CCGAATGTACAGCTTCAGGAAGG - Intergenic
1136571533 16:31100542-31100564 CCCTGTGCACAGTGTCAGCAGGG - Intergenic
1139126886 16:64088980-64089002 CCGTATCTACAGCTTCATCTTGG + Intergenic
1149812816 17:59693811-59693833 CCGTATGGACAGCCACAGCCTGG + Exonic
1151502711 17:74501845-74501867 CCACATGTACAGCGTCAGCAGGG + Intergenic
1155319880 18:24608806-24608828 CTGTATGTACAGCATCAGCAAGG + Intergenic
1156087499 18:33424549-33424571 CCCTATGCACAGCGTCAGAAGGG - Intronic
1157378131 18:47184946-47184968 CCATATGGACAGCACCAGCAGGG - Intergenic
1158111494 18:53944774-53944796 CCCCATGTACAGCATCAGCAGGG + Intergenic
1158219094 18:55131307-55131329 CCTTCTGTCCAGCGTCAGCCTGG - Intergenic
1158358050 18:56642066-56642088 CTGTATGTACAGTGTCAGCAGGG - Intronic
1159391994 18:67805556-67805578 CCATATGTACAGCGTTATCAGGG - Intergenic
1159524316 18:69568193-69568215 CCATATGCACAGCGTCAGCAGGG + Intronic
1159768793 18:72523263-72523285 CCGTATGTAAAGTTTTAGCAAGG - Intergenic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
925066641 2:932986-933008 CCGCATTTACAGCCTCAGCCAGG + Intergenic
926851983 2:17208773-17208795 CCATATGTACAATGTCAACAGGG - Intergenic
927725087 2:25415837-25415859 CCCTATGTACATCGTCACCTTGG + Intronic
928132672 2:28664405-28664427 ACGCCTGTACAGTGTCAGCAAGG - Intergenic
928854823 2:35790631-35790653 CCATATGTACAACATTAGCAGGG - Intergenic
931298956 2:60957998-60958020 ACATATGTACAGCATCAGCAGGG - Intronic
933641679 2:84769092-84769114 CCATATGTACAGCATCAGCAGGG - Intronic
937064154 2:119004679-119004701 CTGTATGTACAGTGTCTGCAAGG + Intergenic
938011280 2:127831078-127831100 CCATAGGTACAGTGTCAGCAGGG - Intergenic
939057288 2:137380907-137380929 CCATATGTACAGTGTTAGCAGGG - Intronic
939057715 2:137383680-137383702 CCATATGTACAGTGTTAGCAGGG - Intronic
939932561 2:148253766-148253788 CCATATGTAGAGCATTAGCAGGG + Intronic
1171030512 20:21672369-21672391 CAGTAGCTACAGGGTCAGCATGG - Intergenic
1173963581 20:47093718-47093740 CCCTGTGCACAGCGTCAGCAGGG + Intronic
1178019976 21:28396604-28396626 CCATATGTAAAGCATTAGCAGGG - Intergenic
1179985803 21:44919770-44919792 CCGGATGGACAGGGACAGCAGGG + Intronic
1182158595 22:28099384-28099406 CCATATATACGGCGTTAGCAGGG - Intronic
952050256 3:29376419-29376441 CCATATGTAAAGCAGCAGCAGGG + Intronic
952435815 3:33271436-33271458 CCCTGTGCACAGTGTCAGCAAGG + Intergenic
953586672 3:44207312-44207334 GCTGATGTACAGCATCAGCAGGG + Intergenic
953844626 3:46417679-46417701 CCATATGTCCAGTGTCAGCAGGG + Intergenic
959455315 3:106552716-106552738 CCGCATGTACAGTGTCAGGAGGG + Intergenic
959472175 3:106765545-106765567 CCATAGGTACAGTGGCAGCAGGG - Intergenic
959649388 3:108737010-108737032 CTGTATGTACAGCATCAACAAGG - Intergenic
960268768 3:115651324-115651346 CCGTATGTGCAGAGTGTGCATGG - Intronic
963981537 3:151543635-151543657 CCCTGTGCACAGTGTCAGCAGGG + Intergenic
964433261 3:156626432-156626454 CTATATGTACAGCGTTAGCAGGG - Intergenic
969834755 4:9831569-9831591 GTGCATGTACAGTGTCAGCAGGG - Intronic
970083498 4:12317927-12317949 CCGTATGTAATGCTTTAGCAAGG - Intergenic
970337347 4:15062222-15062244 CGGTTTGTTCAGCTTCAGCATGG + Exonic
971249880 4:24965964-24965986 CCATATGTACAGTATTAGCAGGG - Intronic
971250777 4:24971554-24971576 CCGAACGTACAGCATTAGCAGGG - Intronic
971292592 4:25358819-25358841 CCATATGTACAGCGTTAGCAGGG - Intronic
972411854 4:38802912-38802934 GCACCTGTACAGCGTCAGCAGGG - Intronic
972679837 4:41294782-41294804 CCATATGTACAGTGTCAGCAGGG - Intergenic
974091925 4:57320563-57320585 CCATATGTACACATTCAGCAGGG + Intergenic
974341481 4:60619089-60619111 CAGTATGTACAGCATGAGAAAGG + Intergenic
976342615 4:83962534-83962556 CTGTATGTACAGTGTTAGCAGGG + Intergenic
976342983 4:83965200-83965222 CCATATGTAGAGCATTAGCAGGG + Intergenic
977574868 4:98665034-98665056 CCATATGTACAGCATTAGCAGGG + Intergenic
978016912 4:103755140-103755162 CTGTATGTATAGTGTTAGCAGGG - Intergenic
979082048 4:116358035-116358057 CCGTATGTACAGCATCAGCAGGG - Intergenic
979082662 4:116362089-116362111 CCATATGTACAGCATCAGTAGGG - Intergenic
979137255 4:117125275-117125297 CAGCATGTACAGTATCAGCAGGG - Intergenic
981305445 4:143242209-143242231 CTATATGTACAGTGTTAGCAGGG - Intergenic
981693922 4:147540146-147540168 CCTTATGCACAGCCTCAGGAGGG - Intronic
987856473 5:23425406-23425428 CTGTATGTACAGCATTAGCAGGG - Intergenic
991658782 5:68930152-68930174 CGGTATGTACAGCATCAGCAGGG + Intergenic
993985535 5:94592619-94592641 TCCAATGTACAGCTTCAGCAAGG - Intronic
994719807 5:103367351-103367373 CCCCATGCACAGTGTCAGCAGGG + Intergenic
994787741 5:104186372-104186394 CCATATGTACAGTGTCAGCGGGG - Intergenic
994788166 5:104189330-104189352 CCGTATGTACAGCATCAGCAGGG - Intergenic
995361199 5:111299322-111299344 CGTTATGTACAGCATTAGCAGGG - Intronic
996324790 5:122260102-122260124 CCATATGTACAGCATCAGCAAGG + Intergenic
997487669 5:134245358-134245380 CTGTATGCACAGTGTCAGCAAGG + Intergenic
1000410546 5:160932258-160932280 CCATATGTACAGCTTTAGTAGGG + Intergenic
1000411553 5:160938608-160938630 CCATATATACAGCATTAGCAGGG + Intergenic
1001006686 5:168057975-168057997 CTGGATGTACAGCATCAGCAGGG + Intronic
1003917715 6:10803090-10803112 CTGTCTGTACAGTGTCAGCTGGG + Intronic
1005258896 6:24035358-24035380 GCGCCTGTACAGCGTCAGCAGGG + Intergenic
1005696097 6:28354204-28354226 TCCTATGTACAGTGTCAGCAGGG + Intronic
1007275628 6:40671445-40671467 CCTCTTGCACAGCGTCAGCAGGG + Intergenic
1009681278 6:66896723-66896745 TCATATGTACAGCTTTAGCAGGG - Intergenic
1009712684 6:67346212-67346234 CTGTATGTACAGTGTTAGCAGGG - Intergenic
1009713059 6:67348873-67348895 CCATATGTCCAGCATTAGCAGGG - Intergenic
1010723237 6:79307713-79307735 CCATATGTGCAGCATCAGCAAGG + Intergenic
1010724095 6:79313336-79313358 CCATATGTACAGCATCAGCAAGG + Intergenic
1011113835 6:83867853-83867875 CTGTATGTACAGCGTAAGCAGGG - Intronic
1012373394 6:98532322-98532344 CCATACGTACAGCATTAGCAGGG - Intergenic
1012416516 6:99019427-99019449 CTGTATGTACAGTGTTAGCAGGG + Intergenic
1012417563 6:99026233-99026255 CTGCATGTACAGCGTTAGCAGGG + Intergenic
1014178255 6:118353633-118353655 CCATATGTACAGCGTTAGCAGGG + Intergenic
1014645047 6:123962811-123962833 CTGTACGTACAGCGTTAGCAGGG - Intronic
1014752085 6:125268094-125268116 CTATATGTACAGCATCAGCTGGG - Intronic
1014753086 6:125274308-125274330 CCATATGTACAGCATCAGCAGGG - Intronic
1015596391 6:134871540-134871562 CTGTATGTACAGCATCAGTAGGG + Intergenic
1015597005 6:134875432-134875454 CCATACGTACAGCATCAGCAGGG + Intergenic
1017300089 6:152846899-152846921 CCGTATGTACAGCATCAGCAGGG + Intergenic
1018536595 6:164827054-164827076 CCCTGTGCACAGCATCAGCAGGG - Intergenic
1018568408 6:165182365-165182387 CCATAGGTACAGTGTTAGCAGGG - Intergenic
1027684352 7:81264194-81264216 CTGTATGTACAGCATTAGCAGGG + Intergenic
1027684905 7:81267582-81267604 CTGTATGTACAGCATTAGCAGGG + Intergenic
1027754999 7:82202180-82202202 CCGTATGTACAGCGTCAGCAGGG - Intronic
1027755435 7:82205022-82205044 CTGCATGTACAGTGTCAGCAGGG - Intronic
1028093682 7:86733820-86733842 CCATATGTACAGCATTAGCAGGG + Intronic
1028432813 7:90767113-90767135 CCCCATGCACAGTGTCAGCAGGG + Intronic
1037623770 8:20590067-20590089 GCTCATGTACAGTGTCAGCAGGG + Intergenic
1038500142 8:28037023-28037045 CTGTATGTACAGCGTTAGCAGGG - Intronic
1039334728 8:36576309-36576331 CCATATGTACAGCATTAGCAGGG + Intergenic
1044775726 8:95685579-95685601 CTGCCTGTACAGCATCAGCAGGG + Intergenic
1045297149 8:100882054-100882076 CCCCATGCACAGTGTCAGCAGGG + Intergenic
1046526342 8:115386388-115386410 CCGTAGGTAGAGTGGCAGCATGG + Intergenic
1047801748 8:128317325-128317347 CAGTTTGTTCAGCGTCAGCTGGG + Intergenic
1048790741 8:138101048-138101070 CTGTATGTATAGCGTCAGCAGGG - Intergenic
1055336174 9:75235696-75235718 GTATATGTACAGCATCAGCAGGG + Intergenic
1055336725 9:75239240-75239262 CCATATGTACAGCATCAGCAAGG + Intergenic
1058982265 9:110181154-110181176 GCATCTGTACAGTGTCAGCAGGG - Intergenic
1197626447 X:128807647-128807669 CCATGTGTACAGTGTCAGCAGGG - Intergenic