ID: 1027757023

View in Genome Browser
Species Human (GRCh38)
Location 7:82226884-82226906
Sequence TAACTTGTACTATAAAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027757018_1027757023 21 Left 1027757018 7:82226840-82226862 CCTTCTAAAAGAAGAATCAGGTG 0: 1
1: 0
2: 1
3: 27
4: 232
Right 1027757023 7:82226884-82226906 TAACTTGTACTATAAAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027757023 Original CRISPR TAACTTGTACTATAAAAGCT GGG Intronic
No off target data available for this crispr