ID: 1027757814

View in Genome Browser
Species Human (GRCh38)
Location 7:82237513-82237535
Sequence AAGAAGTACTTAAACGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027757814_1027757816 -2 Left 1027757814 7:82237513-82237535 CCTTATTCGTTTAAGTACTTCTT 0: 1
1: 0
2: 0
3: 17
4: 198
Right 1027757816 7:82237534-82237556 TTATTTTATAATCAAATTATGGG 0: 1
1: 0
2: 4
3: 105
4: 1048
1027757814_1027757815 -3 Left 1027757814 7:82237513-82237535 CCTTATTCGTTTAAGTACTTCTT 0: 1
1: 0
2: 0
3: 17
4: 198
Right 1027757815 7:82237533-82237555 CTTATTTTATAATCAAATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027757814 Original CRISPR AAGAAGTACTTAAACGAATA AGG (reversed) Intronic
903796466 1:25932563-25932585 AGGAAGTGCTTATATGAATAAGG - Intergenic
904008373 1:27375655-27375677 AAGAAAGAGTTAAATGAATAAGG + Intergenic
908336172 1:63126208-63126230 AAGAAGTAGTTAAACTGAGAGGG - Intergenic
909367327 1:74842688-74842710 CAGAGGTACATAAAAGAATATGG + Intergenic
910233617 1:85011767-85011789 AAGAAGTCATTATACGAAAAAGG + Intronic
910533190 1:88264844-88264866 AAGAAATACTCAAAAGACTATGG + Intergenic
911493927 1:98606741-98606763 AACAAATACTTCAAGGAATATGG + Intergenic
911513950 1:98844041-98844063 AAGTCGTAACTAAACGAATAGGG + Intergenic
911655467 1:100437823-100437845 AAGACATACTTGAAAGAATAAGG + Intronic
912095120 1:106130543-106130565 GAGAAGTATTTAAAGGTATAAGG - Intergenic
914017592 1:143834511-143834533 AAGAAGTACTGACAAGAATGTGG - Intergenic
914656203 1:149743043-149743065 AAGAAGTACTGACAAGAATGTGG - Intergenic
916221132 1:162446042-162446064 AAGAAGGACAAAAAAGAATAAGG - Intergenic
916395059 1:164377472-164377494 AAAGAGTACTTATACTAATAGGG + Intergenic
916837634 1:168564443-168564465 AAGAAATCATTATACGAATATGG + Intergenic
917130100 1:171732669-171732691 CAGCAGTACTTAAAGGAAAATGG + Intronic
918366985 1:183818611-183818633 ATGAAACACTGAAACGAATAGGG - Intronic
919121050 1:193340560-193340582 AAGAAGTACTGTAATGAAGAGGG + Intergenic
919240607 1:194911447-194911469 AAGGAGTTGTTAAAGGAATATGG - Intergenic
919487302 1:198159910-198159932 AATAAGTACTTAATCTCATAAGG + Intronic
920413543 1:205781932-205781954 AAGAATTACTTAAACTCAGAAGG - Intergenic
924402618 1:243703157-243703179 ATGAACTACCTAAAAGAATATGG + Intronic
1064394566 10:14971057-14971079 AAAAAGTAGATAAACCAATATGG + Intronic
1066592766 10:37013402-37013424 AATAAGTACTTAAATGCACAGGG + Intergenic
1066754558 10:38697733-38697755 AAGAAGGACTATAAAGAATATGG + Intergenic
1067073027 10:43150774-43150796 GAGAAATACTTAAACAAATAAGG - Intronic
1067482879 10:46616343-46616365 AAGAAGTACTGGCAAGAATATGG + Intergenic
1067611875 10:47725322-47725344 AAGAAGTACTGGCAAGAATATGG - Intergenic
1068179569 10:53502040-53502062 AAGGAGTGCTTAAAAGAGTATGG + Intergenic
1068231061 10:54169458-54169480 AAGGAGTGCTTAAAAGAGTATGG - Intronic
1069003913 10:63296828-63296850 ATGAAGTTCTTAAAAGAAAAGGG + Intronic
1069046609 10:63750088-63750110 GACAAATACTTAAAAGAATAGGG - Intergenic
1069504306 10:68983646-68983668 AAGAAGGACTTAAGGGAGTAGGG + Exonic
1071627294 10:87185557-87185579 AAGAAGTACTGGCAAGAATATGG - Intronic
1071797534 10:89022447-89022469 AAGAAGTAGATAAATGAAGAGGG - Intergenic
1072269674 10:93763977-93763999 AAGCAGTACTTAAATCAAAAAGG - Intronic
1073744764 10:106455062-106455084 AAAAAGTACTTACTAGAATAGGG - Intergenic
1073961943 10:108941880-108941902 AATAAGTTATTAAACAAATATGG + Intergenic
1076363529 10:129907146-129907168 AAGAACAACTGAAATGAATACGG + Intronic
1080092390 11:28363548-28363570 ACGAAGTACTTAAAGCAACAAGG - Intergenic
1080422791 11:32126698-32126720 CAGAGGCACTTAAAGGAATAAGG - Intergenic
1081361965 11:42190916-42190938 AAGAAGTACCTAACCAAAGATGG - Intergenic
1082621866 11:55433001-55433023 AAAATGTACTTAAGTGAATAGGG - Intergenic
1082896664 11:58198892-58198914 AAGAAGTATTTAAAGTCATAGGG - Intergenic
1083044825 11:59724809-59724831 AAGAAGTAATTATATGAAAAAGG + Intronic
1083522200 11:63324703-63324725 AAAAACAACTTAAACTAATAAGG + Intronic
1084159323 11:67336942-67336964 AAGAAGTACTTAAAGGAAAGTGG + Intronic
1085159115 11:74324835-74324857 GAGAAGTACTTAAAAGGAAAGGG + Intergenic
1087115638 11:94521587-94521609 AAGAAGTATGTAAAGAAATATGG - Intergenic
1087872764 11:103318164-103318186 AAAAAGTACTTACAAGATTATGG + Intronic
1088073842 11:105822579-105822601 AAGAAGCACATGAACAAATATGG - Intronic
1088724644 11:112623254-112623276 AAGAAGTACTGAAACTCAGAGGG + Intergenic
1090086595 11:123655216-123655238 AAGGAGTAATTAAAGGAAAAGGG - Intronic
1092677492 12:10937869-10937891 ATAAAGTACATAAAAGAATATGG - Exonic
1095382158 12:41608139-41608161 AAGAAATTCTTAAATGAGTACGG - Intergenic
1097401839 12:59137242-59137264 AAGAAGTATGCAAATGAATATGG + Intergenic
1099131546 12:78839658-78839680 AAGAAGAAATTAAACGAAGAGGG + Intergenic
1099400486 12:82197639-82197661 AAGAAGTCATTATACGAAAAAGG + Intergenic
1099636034 12:85212908-85212930 AAGAAGTACTCTATCGAATATGG + Intronic
1099804967 12:87507430-87507452 AAGAAGTACTTGAAGAAATACGG + Intergenic
1100057216 12:90526610-90526632 AAAAATTACTTAATCCAATATGG - Intergenic
1104496474 12:129245012-129245034 AAGCATTAATTAAAAGAATATGG - Intronic
1104631160 12:130403224-130403246 AAGAAATACTTAAATGAACTGGG + Intronic
1105309257 13:19191697-19191719 AAGAATTATTTAAAGAAATATGG + Intergenic
1105528338 13:21196409-21196431 AAGAAGTATTTAAAGAAATATGG - Intergenic
1110662296 13:78071472-78071494 AAGCAGTTTTTAAAAGAATAAGG + Intergenic
1112960392 13:105118383-105118405 AAGAAATATTTAAAAGAATCAGG + Intergenic
1112961243 13:105129548-105129570 ATGAATTACTTAAAGGAATTTGG + Intergenic
1113394179 13:109930214-109930236 AAAAATTACTTAAAAAAATAAGG + Intergenic
1113664775 13:112133849-112133871 AAGAAAAACTTAAATGAAAATGG + Intergenic
1116250511 14:42475794-42475816 AAGAACTATATAAACGCATATGG - Intergenic
1118097411 14:62553015-62553037 AAAAAGTACTAAAAGAAATATGG + Intergenic
1120781183 14:88486993-88487015 AAAAAGTACCTAAACGTATTAGG + Intronic
1122424852 14:101599956-101599978 AAGATGTAGATAAAGGAATAAGG + Intergenic
1122451033 14:101807717-101807739 AAGAACTACTTACATGCATAGGG + Intronic
1126252210 15:46581257-46581279 AACAGGTACTTAGAGGAATAGGG - Intergenic
1131240074 15:90732078-90732100 AAGAAGTAGTTACAAGAAAATGG - Intronic
1134243789 16:12524832-12524854 GAGCAGTACTTACACGAAGAAGG - Exonic
1136728124 16:32379114-32379136 AAGAAGGACTATAAAGAATATGG - Intergenic
1137029771 16:35511101-35511123 AAAAAGTACCATAACGAATATGG + Intergenic
1140919123 16:79520537-79520559 AAGTAGTACATAAATAAATATGG + Intergenic
1141029208 16:80573148-80573170 AAGAAATAAATAAATGAATAAGG - Intergenic
1202998315 16_KI270728v1_random:138640-138662 AAGAAGGACTATAAAGAATATGG + Intergenic
1151357451 17:73568685-73568707 AAAAAGTAGTTAAAGGAATAAGG + Intronic
1153077566 18:1182456-1182478 AAATAGTACTGAAATGAATATGG - Intergenic
1153146716 18:2041434-2041456 ATGAATTACTTAAACCAAAATGG + Intergenic
1153200233 18:2640170-2640192 AAGAAAAACTTAAAAGAATAGGG + Intergenic
1156562721 18:38146825-38146847 AAGCAGTATTTCAATGAATAAGG - Intergenic
1156628503 18:38939415-38939437 AAATAGTACTTGAAAGAATATGG - Intergenic
1158572354 18:58607464-58607486 TAAAAATACTTAAACTAATAAGG - Intronic
1160263636 18:77319243-77319265 AAGAAGTTCTTAAATGAAAGAGG - Intergenic
1163803116 19:19379801-19379823 AGGGATTACTTAAATGAATAAGG - Intergenic
1164831899 19:31329226-31329248 AAGAAGTAATTACACAATTAGGG - Intronic
1167191348 19:47992000-47992022 AAGAAATACTTAAAATAACAGGG + Exonic
926398912 2:12475239-12475261 AAGAAGTACTTAAGTTAAAATGG + Intergenic
927821260 2:26267328-26267350 AAGAAGTACTTAAAAAAAAGAGG + Intronic
928539053 2:32267175-32267197 AAGATGTACTTGAATGAATATGG - Intergenic
932934172 2:76082104-76082126 AAGATGTACTTTAAAGATTAAGG + Intergenic
933876868 2:86628665-86628687 AAGATGTAATTCAACAAATAGGG - Intronic
934317849 2:91941975-91941997 AAGAAGGACTATAAAGAATATGG + Intergenic
935897501 2:107753443-107753465 AAGAAGTAAGGAAAAGAATAAGG - Intergenic
936641916 2:114322464-114322486 AAGAAGTATTTAAAAAAATAAGG - Intergenic
938389813 2:130896269-130896291 CATAAGTACTTACAAGAATATGG - Intronic
938749691 2:134316925-134316947 AGGAAGTATTTAAAACAATAAGG + Intronic
940311253 2:152281026-152281048 AAAAAGTACTCAAAGAAATATGG + Intergenic
941188113 2:162342935-162342957 AAGAAATACTTAAGCCACTAAGG - Intronic
946553260 2:220825474-220825496 AATAAGTATTAAAACAAATATGG - Intergenic
947052013 2:226056163-226056185 AAAAAATACTTAAACAAATGAGG + Intergenic
947957571 2:234206708-234206730 AAACAGTTCTTAAAAGAATATGG - Intergenic
1169666478 20:8042159-8042181 AAGAAGTACTGAAAAAAAAAAGG + Intergenic
1172187926 20:33042913-33042935 AAGAAGCACTTTAAGCAATAAGG + Intronic
1173110091 20:40178862-40178884 AAGAAGTTCTTTAATGTATAAGG - Intergenic
1174854202 20:54027627-54027649 AAGAACTCCTTAAAAGAAGAAGG - Intronic
1177361680 21:20081100-20081122 GAGAAGTGTTTAAAAGAATATGG - Intergenic
1179017824 21:37608604-37608626 TAGAAATACCTAAACGAAGAGGG - Exonic
1180306022 22:11125644-11125666 AAGAAGGACTATAAAGAATATGG + Intergenic
1180544541 22:16487827-16487849 AAGAAGGACTATAAAGAATATGG + Intergenic
1182166013 22:28174102-28174124 AAGAAATACATAGAAGAATAAGG + Intronic
1183657153 22:39193372-39193394 AAAAAGTACTCAAAGAAATAAGG + Intergenic
949095429 3:80213-80235 AAAAAGTACTCAAGCAAATAAGG - Intergenic
953314828 3:41917029-41917051 TAGGAATACTTAAAAGAATAAGG - Intronic
956411045 3:68980004-68980026 AAAAAGTACTTAAACCTAAAAGG - Intronic
956451522 3:69379607-69379629 AAACAGAACTTAAAGGAATATGG - Intronic
957642423 3:82873482-82873504 ATGAAATACTAAAAAGAATAAGG - Intergenic
958007732 3:87833814-87833836 AAGAAGGACTTAAAAAAAAAGGG - Intergenic
961941480 3:130641938-130641960 CAAAAGTACTTAAACTAAAATGG + Intronic
962842450 3:139248078-139248100 AAGACATACTTAAAGAAATATGG - Intronic
964056785 3:152470923-152470945 AAGAAGGAAATAAACTAATATGG - Intergenic
967145844 3:186605364-186605386 GAGAAGTATGTAAAGGAATAGGG + Intergenic
969044422 4:4326470-4326492 AAAAAGTAGTTAAAATAATAGGG - Intergenic
970122837 4:12776416-12776438 AAAAAGTGCTTAAATGAAGATGG - Intergenic
971797598 4:31248857-31248879 AAAAAGTCCTAAAACGCATAGGG + Intergenic
971824788 4:31607030-31607052 AAGCAGTACTTAATCAATTATGG + Intergenic
972452419 4:39215708-39215730 AAAAACTACTTAAACTAGTAAGG + Intronic
975410846 4:74047464-74047486 AAAAATTACTAAAACGTATATGG - Intergenic
979133044 4:117072836-117072858 AAGATTTCCTTAAACCAATAAGG + Intergenic
980266019 4:130517108-130517130 AAAAAGTAATTAAAAGAATCTGG - Intergenic
981078985 4:140619374-140619396 ATGATGTGCTTGAACGAATAAGG + Intergenic
981579543 4:146237971-146237993 GAGAAGTAATTAAACGAGAAGGG + Intergenic
982206741 4:153002152-153002174 AAGAAGTTCTTAAATGTTTAAGG + Intergenic
982531951 4:156556476-156556498 AAGAAGTGCTTAAGAGAGTAAGG - Intergenic
983659657 4:170119155-170119177 AAGGAGTGCTTAAAAGAGTATGG - Intergenic
985009882 4:185571414-185571436 AAAAAGTACTTAGACAACTATGG + Intergenic
986889426 5:12283534-12283556 AAAAGGTACTTTAACGAATATGG - Intergenic
987938739 5:24504359-24504381 AAAAAGTAATTAAATGTATATGG - Intronic
988246748 5:28694202-28694224 AAGAAGTAGCTGAAAGAATATGG + Intergenic
988285238 5:29206326-29206348 AAGTAGTACTTAAGAAAATAAGG + Intergenic
989309351 5:39996442-39996464 AAGAAATACATAAAAGGATATGG - Intergenic
993095735 5:83475424-83475446 AAGAAGTGCTTAAAACAATTAGG - Intronic
995321935 5:110844626-110844648 AAGAGGTAATTAAATTAATATGG + Intergenic
995787789 5:115849080-115849102 AATAAATACTTGAAAGAATATGG - Intronic
997773349 5:136574972-136574994 AAGAAGTACTTCAAAGATAATGG - Intergenic
998989200 5:147796450-147796472 AAGAAGTACTTAAAGAAAGATGG + Intergenic
1000687912 5:164275415-164275437 ATGAAATACTTAAGTGAATATGG - Intergenic
1000867163 5:166527904-166527926 AAGATGTACTTAAACGCTGAGGG + Intergenic
1003451239 6:6234364-6234386 ATGAAGTACTTCAGGGAATATGG + Intronic
1003819475 6:9879749-9879771 AAGAAGTATTAAAAAGAATAAGG + Intronic
1005565136 6:27084284-27084306 AAGAATTGCTTAAACATATAAGG + Intergenic
1006956123 6:37873835-37873857 AGGTAATACATAAACGAATAAGG + Intronic
1007352145 6:41281797-41281819 AAGCAGTTCTGAAATGAATAGGG + Intronic
1007965285 6:45998787-45998809 AAGAAGGAATTGAACGAATGTGG - Intronic
1009317284 6:62236537-62236559 AACAAGTATTTAAAAGGATAAGG + Intronic
1011034176 6:82955569-82955591 AAGCAGAACTTAAAGAAATATGG + Intronic
1013341344 6:109219187-109219209 AGGAAGACCTTACACGAATAAGG + Intergenic
1014194545 6:118538988-118539010 ATGAAGTACTTAATACAATATGG + Intronic
1015807690 6:137128025-137128047 AAGAAGTCATTATACGAAAAAGG - Intergenic
1016193355 6:141298670-141298692 AAGAACTGGTTAAACAAATATGG + Intergenic
1016554486 6:145320564-145320586 TAAAAGTACTTAAAGAAATATGG - Intergenic
1017388907 6:153916822-153916844 AAGAAGTGCCCAAATGAATAAGG - Intergenic
1017413317 6:154193035-154193057 AAGAAGTCATTATACGAAGAAGG + Intronic
1017733162 6:157336259-157336281 CAGAGGTCCTTATACGAATAAGG - Intergenic
1018228088 6:161649362-161649384 AAGAAGTACTTGAAACAGTAAGG + Intronic
1020943432 7:14569330-14569352 CAGAACTAATTAAACAAATAAGG - Intronic
1020986978 7:15148121-15148143 AAGGAGTAGTAAAACAAATATGG - Intergenic
1022483885 7:30762975-30762997 AGGAAGTACTCAAAAAAATAAGG - Intronic
1023301338 7:38775457-38775479 AAGAAGCAGTAAAACGAAAAAGG - Intronic
1023767011 7:43521201-43521223 AAGAAGTGATTAAACGATGAGGG + Intronic
1024281477 7:47722878-47722900 AAGAAGTAATTAAAGTAAAATGG - Intronic
1027757814 7:82237513-82237535 AAGAAGTACTTAAACGAATAAGG - Intronic
1028662393 7:93294611-93294633 AACATGGACTTACACGAATATGG + Exonic
1028839605 7:95414010-95414032 AAAAAATACTTAAATAAATAAGG - Intronic
1031253884 7:119422683-119422705 AAAAAGAATTTAAAAGAATAAGG + Intergenic
1034288887 7:149911676-149911698 AAAAAACACTGAAACGAATATGG + Intergenic
1034662187 7:152781176-152781198 AAAAACCACTGAAACGAATATGG - Intronic
1035963526 8:4164610-4164632 CAGAAGTATGTAAACCAATAAGG - Intronic
1041235027 8:55792253-55792275 AAAAATTACTAAAAAGAATAAGG - Intronic
1042811502 8:72830483-72830505 AAGCAGTTCTTACATGAATAAGG - Intronic
1043624543 8:82239933-82239955 AAGAAGTTTTAAAACGTATATGG + Intergenic
1044313245 8:90719673-90719695 AAGAAGTATTTATATTAATAAGG - Intronic
1044362847 8:91308862-91308884 AACAAGTAAATAAACAAATAAGG - Intronic
1045613515 8:103877033-103877055 AAGAAGTTCTTATACGAAAAAGG - Intronic
1046450119 8:114378321-114378343 ATGAGGAACTTAAACAAATAAGG + Intergenic
1046861599 8:119098712-119098734 AAGTGGTACTTATAGGAATATGG - Intronic
1050584427 9:7095715-7095737 AATAAGTAATTAAACGAATCTGG + Intergenic
1051330307 9:16018499-16018521 AAGAAGTTAATAAATGAATAAGG - Intronic
1051476687 9:17516577-17516599 AAGAAGAATCTAAACAAATAGGG - Intergenic
1052287280 9:26800376-26800398 AAGAATTACTTAAAAGAAAAAGG + Intergenic
1054733481 9:68726099-68726121 TAGAAGTATTTAAACTAAAAGGG + Intronic
1055361631 9:75497185-75497207 ATGAAGTCCTTCAAGGAATAAGG - Intergenic
1058921935 9:109625052-109625074 AAGAAGTACTCAAAGGATGATGG - Intergenic
1059150582 9:111946233-111946255 AGGAAGTACTTAAGAAAATAAGG + Intergenic
1059811639 9:117861745-117861767 AAGAAGAACTTAACATAATAAGG + Intergenic
1188607018 X:32044145-32044167 AAGAAGTATATAAAGGAACATGG + Intronic
1189874998 X:45426912-45426934 AGAAAATACGTAAACGAATAGGG - Intergenic
1190628183 X:52357357-52357379 ATGAAGTACTTACACCAAAAAGG - Intergenic
1190844168 X:54175846-54175868 AATGAGTACTTAGAAGAATAGGG + Intronic
1191922049 X:66267355-66267377 AACAAGTACTTTAATGGATAGGG - Exonic
1195830120 X:109047906-109047928 AAGAAGTACTGAAATTAATGTGG - Intergenic
1196323916 X:114378553-114378575 AAGAAGAACATAAACGTAAAAGG + Intergenic
1196661106 X:118269737-118269759 CAGAAGAAATTAAAGGAATATGG + Intergenic
1197186294 X:123590932-123590954 AAGAGGTACTTAAACACAGAAGG - Intergenic
1198566910 X:137914490-137914512 AAGCTGTACATAAACAAATAGGG + Intergenic
1199246279 X:145608346-145608368 AAGAAATACTTGCACAAATATGG + Intergenic
1199845113 X:151687181-151687203 GAGAAGCATTTAAAGGAATAAGG - Intergenic
1201185415 Y:11397007-11397029 AAGAAGGACTATAAAGAATATGG + Intergenic
1201950073 Y:19554111-19554133 AAGAAATATTTAAAGGAATATGG - Intergenic