ID: 1027758492

View in Genome Browser
Species Human (GRCh38)
Location 7:82247559-82247581
Sequence TACTTTGGACAGACCTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027758492_1027758496 29 Left 1027758492 7:82247559-82247581 CCCACTGAGGTCTGTCCAAAGTA 0: 1
1: 0
2: 3
3: 11
4: 109
Right 1027758496 7:82247611-82247633 GTGCTTTATCATGAAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027758492 Original CRISPR TACTTTGGACAGACCTCAGT GGG (reversed) Intronic
904346465 1:29874914-29874936 TACTTTTGTCAGAAATCAGTTGG - Intergenic
908025823 1:59950679-59950701 GACTTTGGGCAGAGCTCAGCTGG + Intergenic
914332041 1:146681017-146681039 TACTGTGAACAGATCTCAGAAGG + Intergenic
914856564 1:151356098-151356120 TAGTTTGGACAGGGCTCAGCAGG - Intergenic
914921466 1:151850372-151850394 GACTTGGAACAGACCTCAGGAGG - Intronic
917241255 1:172951005-172951027 CAATTTGGACAGACCTTGGTGGG + Intergenic
922538849 1:226403752-226403774 TACTTTAGTCAGATCACAGTTGG - Intronic
1063437811 10:6048750-6048772 TACTTTGGAGAGACAGCATTGGG - Intronic
1066097068 10:32082668-32082690 TACTTTGGAAAGATCTCAAGTGG - Intergenic
1070461797 10:76677727-76677749 TAGTTAGGAGAGACCCCAGTGGG - Intergenic
1075621068 10:123928831-123928853 TAATTTGGACAGAAGCCAGTGGG - Intronic
1075841030 10:125503574-125503596 TTCTTTGGACAGAGCTCAACTGG - Intergenic
1075878561 10:125828758-125828780 CAGTTTGGACAGAGCTCAGTGGG + Intronic
1078867376 11:15310615-15310637 TATCTTGGACACACCTCACTAGG - Intergenic
1080176211 11:29365918-29365940 TATTTTAGACAGAGCACAGTAGG - Intergenic
1080224852 11:29949405-29949427 TACTTTCTAAAGCCCTCAGTGGG - Intergenic
1081085603 11:38796492-38796514 TACATTGGCCAGACTTCAGCTGG + Intergenic
1081283607 11:41241701-41241723 TTCTTTTGACAGAACTCAGTTGG + Intronic
1082290598 11:50365358-50365380 TTTTTTCCACAGACCTCAGTGGG - Intergenic
1084797887 11:71520231-71520253 TGCATGGGACAGACCCCAGTGGG + Intronic
1089758776 11:120707637-120707659 TACTTTGGGCAAGGCTCAGTAGG + Intronic
1094547170 12:31415694-31415716 TACTCTGGACAGGGCTAAGTTGG - Intronic
1094871451 12:34601328-34601350 TGCTTTGGGCAGACCCCCGTGGG - Intergenic
1095541968 12:43320591-43320613 CATTTTGGTCAGACCTCATTTGG - Intergenic
1099097775 12:78396803-78396825 GACTTTGGCAATACCTCAGTTGG + Intergenic
1101767435 12:107714861-107714883 TACTTTGAAAAGACCTCCCTTGG - Intergenic
1107071544 13:36275492-36275514 TTCTGTGGACAGCCCTCACTGGG - Intronic
1112217361 13:97446874-97446896 CAATTTGGGCAGAACTCAGTTGG - Intronic
1114200230 14:20513170-20513192 CACTTTGGGCAAATCTCAGTGGG + Intergenic
1117268865 14:54120511-54120533 TACTTTGGACATACTTCAGTTGG + Intergenic
1119366443 14:74096003-74096025 AACTTTGGATTGACCTCAGTAGG - Intronic
1121470816 14:94152788-94152810 GACTTTGGACTGGCTTCAGTAGG + Intronic
1122438406 14:101713746-101713768 TACTTGGGTGAGATCTCAGTGGG - Intergenic
1124463493 15:29914917-29914939 TATTGTTCACAGACCTCAGTTGG - Intronic
1129303347 15:74639887-74639909 TACTTTCTAGAGACCTCATTGGG + Intronic
1132524181 16:406169-406191 TACTCTGGAGGGACCTCAGGTGG - Intronic
1132566269 16:625028-625050 TACCTGGGACAGAGCTGAGTGGG - Intronic
1137980105 16:53062133-53062155 TACTTTGCCCAGACTTCTGTTGG - Intronic
1140001510 16:71029901-71029923 TACTGTGAACAGATCTCAGAAGG - Intronic
1143419995 17:6781265-6781287 TCCTATGGTCAGATCTCAGTGGG + Intronic
1147778433 17:42920859-42920881 TACTTAAGACAGACCTGAGCTGG - Intergenic
1151177092 17:72297685-72297707 TATTTTGGAAATATCTCAGTAGG - Intergenic
1152412081 17:80131979-80132001 TACTTTAGACATACCTCAAAGGG + Intergenic
1154128356 18:11714203-11714225 TATTTGAGACAGATCTCAGTCGG + Intronic
1158859525 18:61578865-61578887 CACTTTGGACAGGCATCAGATGG - Intergenic
1159042267 18:63335398-63335420 TAATGTGGACAGAAATCAGTCGG + Intronic
1164597110 19:29537572-29537594 TACTTTGGACAGGCTTCAGTTGG + Intronic
1165403532 19:35616853-35616875 TATTTTGGACAGATCTGAGCAGG + Intronic
1166731562 19:45061969-45061991 TGCTTTGGACAGATCTGAGGTGG + Intronic
925855118 2:8121925-8121947 TTCTTTGGACATAGGTCAGTGGG - Intergenic
928612587 2:33005222-33005244 TAAATTGGACAGGGCTCAGTAGG + Intronic
933619330 2:84519263-84519285 TAATTTAGGCAGAGCTCAGTGGG - Intronic
935487355 2:103674319-103674341 TACTTTGGTCAGATCCCACTGGG + Intergenic
936743371 2:115543072-115543094 TACTTTGTGAAAACCTCAGTTGG + Intronic
938060188 2:128248186-128248208 TACCTAGGATAAACCTCAGTGGG - Intronic
938160952 2:128983911-128983933 ACCTTTGGAGAGACCTGAGTGGG - Intergenic
939123829 2:138151255-138151277 CACTTTGGGCAGAAATCAGTTGG - Intergenic
945055487 2:205865251-205865273 GAATTTGGACAGAGCTCAGAGGG - Intergenic
946765813 2:223039219-223039241 TACTCAGGAAAGACCTCAATAGG + Intergenic
1169307263 20:4502850-4502872 TAATTTGGACAGGGCGCAGTTGG + Intergenic
1176943268 21:14949701-14949723 TGATTTGGACAGAGCTCAGTAGG + Intergenic
1181857260 22:25790934-25790956 TACTGTGGACCCAGCTCAGTGGG + Intronic
1181873401 22:25921288-25921310 GACTTCGGAGAGACCTCAGGAGG + Exonic
1182064146 22:27418426-27418448 TATTTTGGACAGAGTTGAGTGGG - Intergenic
949759823 3:7457923-7457945 TAATTTGGTCAGAGCTCTGTGGG - Intronic
949798599 3:7878370-7878392 TACTTTGGCCTGAACTCAGCTGG + Intergenic
949911738 3:8915891-8915913 TATTTTCTACAGACCTCAGTGGG + Intronic
950195440 3:11006072-11006094 TACCTTGCACAGGCCACAGTGGG + Intronic
953031014 3:39179988-39180010 GAATTTGGACAGAGCACAGTGGG - Intergenic
955868414 3:63410636-63410658 TACTTTGGAAACCCATCAGTTGG - Intronic
955930139 3:64048135-64048157 TAATTTCAGCAGACCTCAGTCGG + Intergenic
957272544 3:78050632-78050654 TACTTTGGGCAGAGCTCAGTGGG - Intergenic
957515299 3:81242795-81242817 TACTATGTACAGACTTCTGTAGG + Intergenic
959089085 3:101883122-101883144 TAGCTTGGACAGGACTCAGTGGG - Intergenic
959125130 3:102282113-102282135 TATTTTGGGCTGCCCTCAGTAGG + Intronic
960355871 3:116652562-116652584 TATTTTGGACGGAGCTCAGGAGG + Intronic
961928098 3:130504476-130504498 TAATTTGGACAGGGCTCTGTAGG - Intergenic
962875240 3:139531002-139531024 CAATTTGGACAGGGCTCAGTGGG - Intronic
971140054 4:23915119-23915141 TACTTTGGACTGACTCCATTTGG + Intergenic
977397693 4:96491074-96491096 TACTTTGAAATGTCCTCAGTGGG - Intergenic
979154790 4:117371066-117371088 TACTTTGGTCAGACATTAGAGGG - Intergenic
986468238 5:8048429-8048451 TCATTGGCACAGACCTCAGTAGG + Intergenic
989617897 5:43355898-43355920 AACATTGGACAAACCCCAGTTGG - Intergenic
990809773 5:59709877-59709899 TACTTTAGACAGAACTCTGCAGG + Intronic
990847940 5:60165290-60165312 CACTTTTGACAAAACTCAGTTGG + Intronic
991418882 5:66420265-66420287 TGCTTTGGTCAGAGATCAGTTGG + Intergenic
992180972 5:74198024-74198046 GAATTTGAACAGAGCTCAGTGGG - Intergenic
993136353 5:83970849-83970871 TGCTTTGGACAGAACAAAGTTGG + Intronic
995014864 5:107298509-107298531 AACTTTAATCAGACCTCAGTAGG + Intergenic
995129737 5:108617821-108617843 TACTCTGCACAGACCCCAGTGGG + Intergenic
996204173 5:120710793-120710815 TACCTTGGATAAACCTCAGTGGG + Intergenic
998436419 5:142112893-142112915 TATTTTAGAAAGACCTAAGTAGG + Intronic
1001324866 5:170715861-170715883 GACTTTGAACAAACCTCAGAAGG + Intronic
1001439500 5:171730190-171730212 TTCTTGGGATAGACCCCAGTTGG - Intergenic
1002343394 5:178531670-178531692 TAAGTTGGAAAGACCACAGTAGG - Intronic
1002549198 5:179974460-179974482 TACTGTGGACAGATGGCAGTTGG - Intronic
1005805038 6:29466685-29466707 TGCTTTGAACAGACCTGAGCAGG + Intergenic
1005848645 6:29802025-29802047 TGCTGAGGACAGACCTCAGGAGG + Intergenic
1005864742 6:29928827-29928849 TGCTGAGGACAGACCTCAGGAGG + Intergenic
1005906055 6:30261953-30261975 TACTGAGGACAGACCTCAGGAGG + Intergenic
1005971806 6:30767659-30767681 GAATTTGGACACACCGCAGTGGG + Intergenic
1006963668 6:37960431-37960453 TACTTTGGACAGAAGGCAATGGG + Intronic
1007034652 6:38662174-38662196 TACTTTGGCCTGAACTCAGCTGG - Intergenic
1007171695 6:39868684-39868706 TAAATTGGACAGACCTGATTGGG + Intronic
1018440591 6:163808704-163808726 TATTCTGGACAGAAGTCAGTGGG + Intergenic
1025708117 7:63885750-63885772 TACTTTGGACAGACCACTCTGGG + Intergenic
1026490829 7:70861917-70861939 GACTTTGGACAGGGCACAGTGGG - Intergenic
1027758492 7:82247559-82247581 TACTTTGGACAGACCTCAGTGGG - Intronic
1031866240 7:127040665-127040687 TGCTTTGGACAAGCCTCAGTGGG - Intronic
1031915710 7:127561033-127561055 TTCTATGGACAGACATCAGAAGG + Intergenic
1034012924 7:147549669-147549691 TACTTTTTATAGACCTCAGCAGG - Intronic
1036979015 8:13447967-13447989 TACTGTGGACAGATTTCAGGAGG - Intronic
1041951006 8:63501991-63502013 TACTTGGGAAAGACCTCAGAAGG - Intergenic
1043500302 8:80847672-80847694 TACCTTTGACAGAAATCAGTTGG - Intronic
1045719954 8:105097522-105097544 TACATTGGACACAACTCAGCTGG + Intronic
1048117179 8:131537439-131537461 TGCTTAGGAAAGACCTCAGAAGG - Intergenic
1051957230 9:22711132-22711154 TAATTTTGACTGACCTAAGTAGG + Intergenic
1053312967 9:37030955-37030977 AAGTTTAGACAGAACTCAGTGGG - Intronic
1185820711 X:3200997-3201019 TAATTTGGGCAGGGCTCAGTGGG - Intergenic
1187411208 X:19051887-19051909 TAATTTGGGCAGAGCTCAGCAGG - Intronic
1188161997 X:26815348-26815370 AACATGGGACAGAACTCAGTCGG - Intergenic
1191251134 X:58260718-58260740 TACTTTGGGGTGACCCCAGTGGG - Intergenic
1199461534 X:148090831-148090853 TACTCTGGAGAGACCTCTCTGGG + Intergenic
1199549152 X:149039735-149039757 TACTTTCCATAGACCTCAGCTGG + Intergenic