ID: 1027758493

View in Genome Browser
Species Human (GRCh38)
Location 7:82247560-82247582
Sequence TTACTTTGGACAGACCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027758493_1027758496 28 Left 1027758493 7:82247560-82247582 CCACTGAGGTCTGTCCAAAGTAA 0: 1
1: 0
2: 1
3: 13
4: 123
Right 1027758496 7:82247611-82247633 GTGCTTTATCATGAAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027758493 Original CRISPR TTACTTTGGACAGACCTCAG TGG (reversed) Intronic
901584158 1:10273541-10273563 TTAGATTGCACAGACCTCAAGGG - Intronic
903015488 1:20358883-20358905 TGACCTTGGACAGATCTCTGCGG - Intergenic
903292006 1:22319898-22319920 GTAATTTGGACAGGGCTCAGTGG - Intergenic
903779751 1:25813804-25813826 TTGCTTTGGGGAGACCTCACGGG - Intronic
903864927 1:26390991-26391013 TTACTTTGGAAAGGCCTCAGAGG + Intergenic
905354589 1:37372529-37372551 TTAATTTGGACACACCACACTGG + Intergenic
905857776 1:41325963-41325985 GGAATTTGGACAGACCACAGTGG + Intergenic
908793360 1:67804979-67805001 TTAATATGGACTGCCCTCAGAGG + Intronic
910033964 1:82767610-82767632 TTTCTTTAAACACACCTCAGAGG - Intergenic
911446808 1:98004774-98004796 TTAATTTGGACAGATCTGTGGGG - Intergenic
914762273 1:150608575-150608597 GTACATTGGACAAACCTCATTGG + Intronic
917000699 1:170354876-170354898 TTGCATTGGACTGCCCTCAGAGG + Intergenic
917562187 1:176170308-176170330 TTACTTTGCCCAGATCTCAGAGG + Intronic
917600506 1:176569301-176569323 TTACAAAGGACAGACATCAGGGG - Intronic
918674612 1:187267385-187267407 TTCCTATGGACAGCTCTCAGTGG - Intergenic
921030135 1:211329069-211329091 TTGCTGGGGACAGACCACAGAGG - Intronic
921165354 1:212503078-212503100 TTCCATAGGCCAGACCTCAGTGG - Intergenic
923302023 1:232650261-232650283 GTAATTTGGACAGGGCTCAGTGG - Intergenic
924013910 1:239698766-239698788 ATACCTTGGTCAGAGCTCAGAGG - Intronic
1063205034 10:3822797-3822819 TAACTGTGGACAGAGCCCAGCGG + Intergenic
1064526467 10:16261214-16261236 TTGCTTTCATCAGACCTCAGAGG + Intergenic
1064917220 10:20473212-20473234 GTACTTTGGACACACAGCAGAGG - Intergenic
1070286015 10:75084329-75084351 ATACTTTGGCCAGACCACACCGG + Intergenic
1071715922 10:88095275-88095297 TTCCTGTGGATGGACCTCAGAGG + Intergenic
1072069122 10:91899621-91899643 TCACATTGGACAGGCCTCATTGG - Intergenic
1073543953 10:104333794-104333816 GTCCTTTGTCCAGACCTCAGAGG + Exonic
1075492309 10:122882026-122882048 TTTCTTTGGACCTACCTCATGGG + Intergenic
1075878560 10:125828757-125828779 ACAGTTTGGACAGAGCTCAGTGG + Intronic
1076508429 10:130994170-130994192 TCACCTTGGAGAGACCTCAGAGG + Intergenic
1076858732 10:133129714-133129736 TTCCTTGTGAAAGACCTCAGCGG + Exonic
1082290599 11:50365359-50365381 TTTTTTTCCACAGACCTCAGTGG - Intergenic
1083408906 11:62478272-62478294 TTAGTGTGAAAAGACCTCAGGGG - Intronic
1085059937 11:73436279-73436301 TTACTTTCAACAGAAATCAGGGG + Intronic
1089514259 11:119021935-119021957 TAACTTTGGACAGAGCACACAGG - Intronic
1090594210 11:128303638-128303660 ATACTTGGGAAAGACCTTAGAGG - Intergenic
1096143746 12:49264444-49264466 TCTCTCTGGACAGCCCTCAGCGG + Intronic
1096591825 12:52665194-52665216 TCTCTTAGGAAAGACCTCAGGGG - Intergenic
1101433790 12:104648120-104648142 TTTATTTGGAGACACCTCAGAGG + Intronic
1101574407 12:105984090-105984112 TTGGTTGGGACAGAACTCAGAGG - Intergenic
1106400655 13:29427016-29427038 TGAGCTTGGGCAGACCTCAGAGG - Intronic
1107996294 13:45864528-45864550 TTACTTTGCCCAGACTTGAGAGG + Intergenic
1110467900 13:75824003-75824025 TTACTTTGAACAGATCTTGGAGG + Intronic
1111368909 13:87289987-87290009 TTACTTTTGACATACTCCAGTGG - Intergenic
1112357040 13:98682310-98682332 TCAAGTTGCACAGACCTCAGTGG - Intergenic
1114200229 14:20513169-20513191 TCACTTTGGGCAAATCTCAGTGG + Intergenic
1114409126 14:22484362-22484384 TTAATTTGATAAGACCTCAGTGG - Intergenic
1116551741 14:46248821-46248843 TTACTTTGAACAGAACTCCATGG + Intergenic
1124592974 15:31069631-31069653 AAGCTGTGGACAGACCTCAGAGG + Intronic
1125871961 15:43110177-43110199 TTACTTTGGGCAGGGCTCAGTGG - Intronic
1126397800 15:48237700-48237722 TTACTATATACAGAACTCAGGGG + Intronic
1128200323 15:65799902-65799924 TGACTTTGGACAAGCCGCAGAGG - Intronic
1130551098 15:84890351-84890373 TTACTGGGGACATACCTGAGTGG + Intronic
1132071173 15:98777614-98777636 TGACTTTGGACAGCCCCCACAGG - Intronic
1135503136 16:23014326-23014348 TGACTTGTCACAGACCTCAGTGG - Intergenic
1143759136 17:9088461-9088483 TTGCTTTGGAGGGACCTCAGAGG - Intronic
1146034311 17:29391689-29391711 TTCCCATGGACAGATCTCAGGGG - Intronic
1152412080 17:80131978-80132000 ATACTTTAGACATACCTCAAAGG + Intergenic
1152547527 17:81009290-81009312 TTACTTTGCAGAGTCCTCAGTGG - Intronic
1154341192 18:13503711-13503733 TTATTTTGGGCAGGCCTCATAGG + Intronic
1156514495 18:37668742-37668764 TTATTTTGGACAGAACTGAGAGG + Intergenic
1160947093 19:1648708-1648730 TTGTTTTTGACAGACCTCAGTGG + Intronic
1161010684 19:1958213-1958235 GTGCTCTGGACAGACATCAGGGG - Intronic
1163608798 19:18290652-18290674 TCAGTGTGGACAGACGTCAGGGG - Intergenic
1167134104 19:47607087-47607109 TTAATTTTGAGAGACCACAGAGG - Intergenic
925751292 2:7092012-7092034 TCCCTGTGGACAGAACTCAGGGG - Intergenic
926032479 2:9604086-9604108 TGACTTTGGACAGAGGTCAGTGG - Intronic
932152999 2:69389989-69390011 TTTCTTTTCACAGGCCTCAGGGG - Intergenic
932426694 2:71642112-71642134 TTTCTTTGTACAGAACTCACTGG + Intronic
935825047 2:106937824-106937846 TTACTATTAACAGATCTCAGTGG + Intergenic
944040879 2:195352823-195352845 TCACTTTCCACAGACTTCAGAGG + Intergenic
945055488 2:205865252-205865274 GGAATTTGGACAGAGCTCAGAGG - Intergenic
945502423 2:210592567-210592589 TTACTCTGAACAGAACCCAGAGG + Intronic
947370340 2:229439305-229439327 TTACTTGGGAAAGACCACTGAGG - Intronic
947490507 2:230590630-230590652 GCAGTTTGGACAGAGCTCAGTGG - Intergenic
948754289 2:240150175-240150197 TGCCTTTGGAGAGAGCTCAGCGG + Intergenic
1174612058 20:51805951-51805973 TAACTTTGCACAGGTCTCAGTGG + Intergenic
1175085032 20:56451275-56451297 CTTCTTACGACAGACCTCAGGGG + Intronic
1175546969 20:59784693-59784715 TGACTTGGGACAACCCTCAGAGG - Intronic
1179609412 21:42540216-42540238 TCACTGTGGACAGACCTAGGTGG - Intronic
949210233 3:1490311-1490333 TTACTTTAGACAGATTTCAAAGG - Intergenic
949248240 3:1950695-1950717 TAACTTTGTACAAACTTCAGTGG + Intergenic
949911737 3:8915890-8915912 CTATTTTCTACAGACCTCAGTGG + Intronic
950093334 3:10312780-10312802 CTACTTTGGACAGAACTAAATGG + Intronic
950400121 3:12763370-12763392 TTGCTGTGGGCAGATCTCAGGGG + Intronic
956065109 3:65389702-65389724 TTCCTTTAGTCAGGCCTCAGGGG + Intronic
957272545 3:78050633-78050655 GTACTTTGGGCAGAGCTCAGTGG - Intergenic
959647641 3:108721793-108721815 GTCCTTTGGACAGATCTCATGGG - Intergenic
962026644 3:131554754-131554776 GTACTTAGCTCAGACCTCAGAGG + Intronic
966396801 3:179512150-179512172 TTATTTTGGCCAGACCTCCCAGG + Intergenic
972307516 4:37846131-37846153 TTAGTTTGGACAGACCAGGGAGG + Intronic
973107202 4:46354992-46355014 TCACTTTATACAGACCTCACAGG + Intronic
975495420 4:75030923-75030945 TTAGTTTAAACAGAACTCAGGGG + Intronic
977294795 4:95198603-95198625 TTCCTTTGCACAGAGCTCTGTGG - Intronic
977450940 4:97197019-97197041 TAACTGTGGACAAACCTCATTGG - Intronic
977500934 4:97835686-97835708 TTACTTTGCCCAGATCCCAGAGG - Intronic
978305683 4:107325861-107325883 TTACTTTGGACAGAGGGAAGAGG + Intergenic
979154791 4:117371067-117371089 GTACTTTGGTCAGACATTAGAGG - Intergenic
981711194 4:147710242-147710264 TTATGTTGTATAGACCTCAGAGG - Intergenic
982423604 4:155229058-155229080 TTACTTTGAAAAGACATCAAAGG + Intergenic
984780321 4:183519832-183519854 TTTGGTAGGACAGACCTCAGTGG - Intergenic
989341354 5:40379134-40379156 TTACTTTGGATGGTCCTTAGGGG - Intergenic
991190594 5:63868574-63868596 TTACTATGGAAAGACCCCAAAGG - Intergenic
994265615 5:97712666-97712688 TTACTTTGTGCAGAATTCAGAGG + Intergenic
995129736 5:108617820-108617842 CTACTCTGCACAGACCCCAGTGG + Intergenic
996204172 5:120710792-120710814 ATACCTTGGATAAACCTCAGTGG + Intergenic
996375295 5:122799707-122799729 TTTCTTTGGACAGCCCTGAAAGG + Exonic
1000926833 5:167204375-167204397 TTAATGTGGACAAACCACAGTGG + Intergenic
1002832403 6:834573-834595 TGACTCTGGACAGACTTGAGAGG + Intergenic
1004719967 6:18260621-18260643 TTTCTTAGGACAGACTTCAGAGG + Intronic
1006963667 6:37960430-37960452 TTACTTTGGACAGAAGGCAATGG + Intronic
1010340868 6:74750965-74750987 TTTCTTTGTCCAGAACTCAGAGG + Intergenic
1012402566 6:98855182-98855204 TCACATTTGACATACCTCAGAGG - Intergenic
1015551690 6:134418832-134418854 CTCCTGTGGACAGAACTCAGAGG + Intergenic
1016744105 6:147559613-147559635 TTACTAAGGACACACCTCGGAGG + Intronic
1025708116 7:63885749-63885771 ATACTTTGGACAGACCACTCTGG + Intergenic
1027758493 7:82247560-82247582 TTACTTTGGACAGACCTCAGTGG - Intronic
1027891800 7:83987344-83987366 TTTCTTGGTACAAACCTCAGTGG - Intronic
1030120226 7:106102559-106102581 TGACTGTTGACAAACCTCAGAGG - Intronic
1031866241 7:127040666-127040688 TTGCTTTGGACAAGCCTCAGTGG - Intronic
1041214606 8:55587303-55587325 TTACTTTTCACAGACTGCAGAGG + Intergenic
1044723506 8:95172913-95172935 TTACTCTGGACTAAGCTCAGAGG + Intergenic
1045163594 8:99577848-99577870 TTGCTGTGGACTGACCTCAGAGG + Intronic
1045659814 8:104425726-104425748 TTAATGTGGACAGAATTCAGAGG + Intronic
1046246945 8:111576142-111576164 TTCCGTTGGACAGAACACAGTGG + Intergenic
1046314833 8:112485892-112485914 GCACTTTTGACAGACCTTAGAGG + Intronic
1047246428 8:123149115-123149137 TTTCTGCGGACAGAACTCAGCGG - Intronic
1054853027 9:69868276-69868298 TTTTTTTGGACAGACATCAAAGG + Intronic
1054902538 9:70384420-70384442 TTACTATTCACAGACCTCTGAGG - Intergenic
1055677295 9:78677480-78677502 TTAGTTTGAACAGACCTACGTGG + Intergenic
1059539556 9:115117217-115117239 GTACTTTGGAAAGAACACAGGGG - Intronic
1059602181 9:115790973-115790995 CTACTTTGTGCATACCTCAGAGG + Intergenic
1061008018 9:127939223-127939245 TTACTTTGGGCCGAGCGCAGTGG - Intergenic
1188277593 X:28219526-28219548 TTATTTTGGACAGTTCCCAGTGG - Intergenic
1189357037 X:40317866-40317888 TTCCTTTGAACACACCTCATGGG + Intergenic
1196363063 X:114889420-114889442 TTGCTTAGGAAAGACCTGAGAGG - Intronic
1199312672 X:146339731-146339753 TTATATTGGACAGACTTAAGAGG + Intergenic
1199504370 X:148544738-148544760 TTCATGTGGACAGAGCTCAGTGG - Intronic
1201491707 Y:14548967-14548989 TTCCTTTGGAGAGACCCCAGGGG + Intronic