ID: 1027758494

View in Genome Browser
Species Human (GRCh38)
Location 7:82247574-82247596
Sequence ATGCATGCTTGGATTTACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027758494_1027758496 14 Left 1027758494 7:82247574-82247596 CCAAAGTAAATCCAAGCATGCAT 0: 1
1: 0
2: 4
3: 21
4: 180
Right 1027758496 7:82247611-82247633 GTGCTTTATCATGAAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027758494 Original CRISPR ATGCATGCTTGGATTTACTT TGG (reversed) Intronic
902135504 1:14301418-14301440 TTGCATGATGGGATTGACTTTGG + Intergenic
902155695 1:14484071-14484093 ATAGATGCATGGATTTATTTCGG + Intergenic
903880711 1:26507308-26507330 ACTCCTGCTTGGATTTTCTTGGG - Intergenic
904803374 1:33113315-33113337 TTACATTCTTGGATGTACTTGGG - Intronic
905100839 1:35520775-35520797 CTGCATGCTGGGAATTACTTTGG + Intronic
907137808 1:52156115-52156137 ATGCATTCATGGTTTTGCTTTGG - Intronic
907331700 1:53676090-53676112 ATTAATCCTTGGATTCACTTTGG + Intronic
907968675 1:59359103-59359125 TTGCTTGCTTTGCTTTACTTAGG - Intronic
909755943 1:79225598-79225620 ATGCATGTTTGTATTTACTTTGG - Intergenic
911275149 1:95850980-95851002 ATGCATGACTGTATTTACCTAGG - Intergenic
914230170 1:145758691-145758713 ATGAATGCTTGGAATTACGAGGG + Intronic
916370586 1:164090011-164090033 CAGCATGCTGGGCTTTACTTTGG - Intergenic
916697594 1:167255359-167255381 CTGCATACTGGAATTTACTTAGG - Intronic
921543038 1:216442249-216442271 AACCTTGCTTGGATTTTCTTTGG - Intergenic
923709441 1:236374397-236374419 ATGCATACCTGTAATTACTTGGG - Intronic
1063779529 10:9305349-9305371 ATCCAGGCTTGCATTTACTATGG - Intergenic
1065394468 10:25219079-25219101 TTACATGATTGGATTAACTTTGG + Intronic
1065711996 10:28527383-28527405 ATGAATGGTTGGATTAACTCAGG + Intergenic
1068047258 10:51902749-51902771 ATGCATGCTTGTTTGTTCTTGGG - Intronic
1068095920 10:52491144-52491166 ATGCATGCTTTGTTTCAATTAGG - Intergenic
1071195570 10:83155001-83155023 AAACTTGCTTAGATTTACTTAGG + Intergenic
1072762560 10:98068943-98068965 ACTCACACTTGGATTTACTTTGG - Intergenic
1072992396 10:100209503-100209525 ATGCATACTTGGAATTCCTTGGG - Intronic
1073621977 10:105059474-105059496 ATGCCTGTTTAGATGTACTTAGG + Intronic
1075293977 10:121256580-121256602 ATACTTGCTGGGATTTATTTAGG - Intergenic
1080062498 11:27971801-27971823 ATGCAAGCTTTGATTGAATTTGG - Intergenic
1081210239 11:40324359-40324381 ATTCAAGCATGGATTTACTAAGG - Intronic
1089994146 11:122888990-122889012 ATGCATGCAAGGCTTTCCTTAGG + Intronic
1091055489 11:132414469-132414491 ATGCATCTTAGGTTTTACTTGGG - Intergenic
1092672008 12:10874112-10874134 TTGCTTGCATGGATTTTCTTGGG + Intronic
1093045538 12:14439832-14439854 ATGGATGGATGGATTTATTTTGG - Intronic
1093840049 12:23886875-23886897 ATGGACATTTGGATTTACTTAGG + Intronic
1094694419 12:32803400-32803422 ATGCAATGTTGGATTTAATTAGG + Intronic
1098938426 12:76507067-76507089 ATGCAGGCCTGGCTTTAGTTTGG - Intronic
1100744218 12:97627789-97627811 TTGGATTCTTGAATTTACTTTGG + Intergenic
1101522282 12:105495047-105495069 AGGCATTCTTGGATCTTCTTGGG + Intergenic
1101529903 12:105564273-105564295 ATGCATGCATGGGTCTACTATGG - Intergenic
1107261012 13:38491149-38491171 ATTCATTTCTGGATTTACTTGGG + Intergenic
1107488211 13:40852582-40852604 ATAAATGCATGGATTTATTTTGG - Intergenic
1107888136 13:44891506-44891528 ATGCAGGCTTGCATTCACTCAGG + Intergenic
1108009057 13:45985069-45985091 AGGCATGACTGGATATACTTAGG + Intronic
1109640793 13:65189129-65189151 ATGTATGCTTGGATGAACATCGG - Intergenic
1110588686 13:77227316-77227338 ATCCATTCTTTGATTTAATTTGG - Intronic
1111382074 13:87469718-87469740 ATGCATTCTTTGATTTCATTTGG - Intergenic
1111679189 13:91423501-91423523 AGGCATTCTTGGATATACATAGG + Intronic
1115382250 14:32753828-32753850 ATGAATGTGTGGATTTATTTTGG + Intronic
1115460554 14:33655382-33655404 ATGCATGCTTGGATTTATCTGGG - Intronic
1116349530 14:43842861-43842883 GTACATGCTTGGGTTTATTTTGG + Intergenic
1117287395 14:54300002-54300024 AGGCATGCTTCCATTTGCTTCGG + Intergenic
1119190161 14:72676053-72676075 AGAGATGCTTGGATTTTCTTAGG - Intronic
1120107912 14:80517246-80517268 ATCCTTGCTTTGACTTACTTTGG + Intronic
1123193676 14:106595694-106595716 ATGCTAACTTTGATTTACTTGGG - Intergenic
1123202300 14:106677922-106677944 ATGCTAACTTTGATTTACTTGGG - Intergenic
1123220998 14:106855394-106855416 ATGCTAACTTTGATTTACTTGGG - Intergenic
1127015263 15:54677904-54677926 TTGAATGCTTGGTTCTACTTGGG - Intergenic
1127774278 15:62253348-62253370 ATGCATGCTTGGAGCCACTCGGG + Intergenic
1129030885 15:72616799-72616821 CTGCATGCTTGGATCCACATTGG - Intergenic
1129209500 15:74059426-74059448 CTGCATGCTTGGATCCACATGGG + Intergenic
1129477723 15:75797332-75797354 CTGCATGCTTGGATCCACATGGG - Intergenic
1131069673 15:89458115-89458137 ATGAATGCATGCATTCACTTTGG - Intergenic
1134203437 16:12217690-12217712 ATGAATGATTGGATTTACCATGG + Intronic
1134481590 16:14624323-14624345 ATGTATTTTTGGATTTTCTTTGG - Intronic
1139868935 16:70088002-70088024 ATGAATGCTTAGAAATACTTAGG + Intergenic
1140386451 16:74544170-74544192 ATGAATGCTTAGAAGTACTTAGG - Intronic
1140983156 16:80130132-80130154 ATGAATGATTGTATTTAGTTAGG - Intergenic
1141370655 16:83483238-83483260 ATGCATCACTGGATTTACTCTGG - Intronic
1142335080 16:89483373-89483395 ATTCATGCTTGATTTTTCTTTGG - Intronic
1145111622 17:20168231-20168253 ATGCATGGTTGGATTAAATGTGG - Intronic
1146375303 17:32289769-32289791 ATGGATGCTTGGCTTCACTTTGG + Intronic
1147055398 17:37830482-37830504 ATTCATGCTTGGAATTTCCTGGG + Intergenic
1149345877 17:55734982-55735004 ATCCATGTTTAGATTTACTATGG + Intergenic
1151135024 17:71938269-71938291 AAGTATGCTTGGATTCATTTTGG - Intergenic
1151921580 17:77160447-77160469 ATGCATGTTTTGGTTTCCTTTGG + Intronic
1152667015 17:81576995-81577017 GTGCATGCTTTAAATTACTTGGG - Intronic
1152773290 17:82184156-82184178 ATGCATGCATGGAGGTAGTTGGG - Intronic
1153508015 18:5823064-5823086 AGGGATGCATGAATTTACTTTGG + Intergenic
1155462367 18:26097352-26097374 ATGGAGGATTGGATTTACTGAGG - Intergenic
1157599686 18:48886272-48886294 ATGCATGCAAGGATTTTGTTAGG + Intergenic
1157870560 18:51226577-51226599 AAGCATGCTTGGAACTACTTGGG + Intergenic
1159479071 18:68963829-68963851 ATGCATGCATGTACTTATTTTGG + Intronic
1162264016 19:9555246-9555268 AAGTGTGCTTGGATTTAGTTAGG + Intergenic
1168108598 19:54179668-54179690 ATTCCTGCTTGGCTTTACTAGGG + Intronic
928855184 2:35794933-35794955 ATGCATGCTGGGACTTACCTTGG - Intergenic
928954879 2:36855204-36855226 ATGCATACTTGTATCTACATTGG + Exonic
929283480 2:40109047-40109069 GTGCATTCTTGGATTTAACTAGG + Intronic
929291421 2:40196318-40196340 ATGCATGCTTGAGTTTTCTCAGG - Intronic
929508120 2:42544494-42544516 AGTCATGCTTTGATGTACTTAGG + Intronic
931624913 2:64248645-64248667 ATGCATGCTGGGCTTTACCTAGG + Intergenic
933583891 2:84159507-84159529 AAGCAAGCTTGGGTTCACTTGGG + Intergenic
934016526 2:87891574-87891596 ATTCAAGCTTGGAATTTCTTAGG + Intergenic
934168304 2:89317110-89317132 ATGCATGATTGGACTTCCATAGG + Intergenic
934198983 2:89865472-89865494 ATGCATGATTGGACTTCCATAGG - Intergenic
935713092 2:105916582-105916604 CTGCATACTTGAATTTACATGGG - Intergenic
936244409 2:110814074-110814096 ATGCATGGTTGGATTTGCCTTGG + Intronic
938575581 2:132600033-132600055 ATCCATGCTTGTCTATACTTTGG + Intronic
938701484 2:133884101-133884123 ATGCATTCTTGGAGCTTCTTGGG + Intergenic
940026080 2:149209876-149209898 ATGCATGATTGTATGTATTTGGG + Intronic
942669451 2:178358431-178358453 ATATATGTTTGGATTTATTTTGG - Intronic
944700252 2:202239577-202239599 ATTCCTGCTTGGATTTACATTGG + Intergenic
946197140 2:218040445-218040467 TTGCTTGCTAGGATTTTCTTTGG + Intronic
947262876 2:228243357-228243379 CTGCATGCTTGATTTTCCTTTGG - Intergenic
947305732 2:228744492-228744514 CTGCATGACTGTATTTACTTTGG + Intergenic
947687266 2:232099173-232099195 ATACATGATTGGATTCACTTAGG + Intronic
1170067478 20:12329210-12329232 ATGCAAGGTTGGCTTAACTTTGG - Intergenic
1171789014 20:29501296-29501318 ATTCCTGCATTGATTTACTTAGG - Intergenic
1173366481 20:42390415-42390437 ATGGAAGCTGGCATTTACTTTGG - Intronic
1176726021 21:10433249-10433271 AGGTATGCCTGTATTTACTTTGG - Intergenic
1177413046 21:20755644-20755666 ATGGCTGCTTGGTTTTATTTTGG - Intergenic
1177767889 21:25479439-25479461 ATAAATGCCTGGATTTATTTTGG + Intergenic
1178193429 21:30314393-30314415 GTGGATGCTTGCTTTTACTTTGG + Intergenic
1180288351 22:10773864-10773886 AGGTATGCCTGTATTTACTTTGG + Intergenic
1181402518 22:22659866-22659888 AAGCATGTTTGCATTTTCTTGGG + Intergenic
1182610951 22:31547119-31547141 ATGCATGCTTGGGTTTAATTTGG - Intronic
1184322131 22:43750004-43750026 ATGCATGCTTGGACTTGCTAAGG + Intronic
949561471 3:5206574-5206596 CTTCCTGCTTGGATTTTCTTGGG + Intronic
949679156 3:6492683-6492705 TTGCAGGTTTGGAGTTACTTTGG + Intergenic
950265181 3:11568291-11568313 AGTCATGCTTGGATTTCCTAAGG - Intronic
951883723 3:27503852-27503874 ATCTATTCTTGGAATTACTTTGG - Intergenic
955727260 3:61946562-61946584 GTGCATGGTTGAATTTACATGGG + Intronic
956740648 3:72273197-72273219 ACGCTTGCTGGTATTTACTTGGG - Intergenic
957651506 3:83012258-83012280 CTGCATGCTTTGTTTAACTTAGG - Intergenic
959874629 3:111368063-111368085 ATGGATGCTTGGATTAACCATGG - Intronic
960686316 3:120297541-120297563 GTGCATGCTTGGTTTTCTTTTGG + Intergenic
962432828 3:135335849-135335871 ATGCAAGCTTGGATTTAGTAAGG - Intergenic
963206968 3:142646413-142646435 CGGCATGCTTGCATTTGCTTAGG + Intronic
963610759 3:147465227-147465249 AAGAATGCTTGGATTGGCTTGGG - Intronic
967900292 3:194443136-194443158 CTGCATGCTTAGATTTACCTAGG - Intronic
971392150 4:26196087-26196109 ATGGATGTTTGCATTTATTTTGG - Intronic
971836688 4:31774371-31774393 ATAAAAGCTTGGATTTATTTAGG + Intergenic
971883957 4:32418157-32418179 GTACATGCATGGATTTATTTTGG + Intergenic
974825470 4:67122844-67122866 ACACATTGTTGGATTTACTTGGG - Intergenic
974990966 4:69089775-69089797 ATGAATGCTTGAAGTTACTTTGG + Intronic
976339955 4:83935693-83935715 TTCCAAGCTTGGATTTACTGTGG + Intergenic
976478079 4:85507734-85507756 ATGAAATCTTGGATTTACATAGG - Intronic
978508018 4:109481555-109481577 ATGCATGTTGGGATGTTCTTTGG + Intronic
979207185 4:118052572-118052594 AGCCATGCTTGGATTTACCTGGG - Intronic
980753405 4:137123201-137123223 TTGCTTGCTTTGATTTGCTTTGG + Intergenic
981039022 4:140204101-140204123 AAGCTTGCTGGGATTTAATTTGG - Intergenic
981366463 4:143909774-143909796 CTGCATGCTTGTGTTTATTTTGG - Intergenic
981863244 4:149382067-149382089 ATGCATGCTTCGAAATACTATGG - Intergenic
984586406 4:181569549-181569571 TTGCATGCTAGAATTTACCTGGG + Intergenic
987060422 5:14237844-14237866 CTGCTTGCTTGGTTTTAATTTGG + Intronic
987593951 5:19971115-19971137 AAGCATGCTTTGCTTTAATTAGG - Intronic
990316066 5:54584379-54584401 ATGGCTGCTTGGGTTTACTTTGG + Intergenic
992948159 5:81830049-81830071 ATGCATGCAGGGATTTTATTAGG + Intergenic
995197705 5:109392047-109392069 ATGCCTGCTGGGATTTTATTAGG - Intronic
995751589 5:115458139-115458161 ATGCATACTTGGAGTTAATAGGG - Intergenic
996456614 5:123691345-123691367 ATGCTTGCTGGGATTTTGTTTGG + Intergenic
996617922 5:125463769-125463791 ACACATGCTTTGATTTTCTTGGG + Intergenic
997238260 5:132288084-132288106 GTTCCTGCTTGAATTTACTTTGG - Intronic
1002052660 5:176580063-176580085 AGGCATGCTTGGTTTGTCTTTGG - Intronic
1004344330 6:14834307-14834329 ATGAATTCTTGGTTTTATTTTGG + Intergenic
1007944364 6:45812137-45812159 AGGCATGTTTGGAGTTAGTTTGG - Intergenic
1010550526 6:77216751-77216773 AAGCAAACTTGGATTTTCTTAGG - Intergenic
1010714573 6:79213546-79213568 ATAAATGCTTGAATTTTCTTGGG - Intronic
1010825282 6:80465549-80465571 ATGAATGCTTGTATTAACTTAGG + Intergenic
1011396650 6:86917286-86917308 ATGCATGTATGTATTTATTTAGG - Intergenic
1013336878 6:109172442-109172464 ATGAATGTTTTAATTTACTTGGG - Intergenic
1015103344 6:129506989-129507011 ATGCATATTTGCATTTTCTTAGG + Intronic
1015961698 6:138656832-138656854 CTCCAGGCTTGGATATACTTAGG - Intronic
1016553277 6:145306969-145306991 ATGAATGCATGCATTCACTTCGG - Intergenic
1018383031 6:163277013-163277035 ATGCATACTTGGAGTTCCTGAGG - Intronic
1020870020 7:13616939-13616961 ATGCATGCTTTCATTTATCTCGG + Intergenic
1023807334 7:43882323-43882345 ATTCCAGCTTGGAATTACTTGGG + Intronic
1024753169 7:52494115-52494137 ATGCATGCCTTCATTTATTTAGG + Intergenic
1025155613 7:56603418-56603440 GTTCCTGCTTGGATTTACATTGG + Intergenic
1027758494 7:82247574-82247596 ATGCATGCTTGGATTTACTTTGG - Intronic
1027956947 7:84891721-84891743 ATTCATTCTTTGATATACTTGGG - Intergenic
1028931115 7:96414283-96414305 ATGAAAGCTTGAATTTTCTTAGG - Intergenic
1030661695 7:112225617-112225639 ATGCATGGTTGGATGTACTCTGG - Intronic
1031683834 7:124708688-124708710 ATGTATGCTGGCATTTATTTTGG + Intergenic
1032609334 7:133394480-133394502 ATGCATGCTCTGATTAACTAGGG - Intronic
1034611900 7:152378637-152378659 AGGTATGCCTGTATTTACTTTGG + Intronic
1034719244 7:153273462-153273484 ATGCATGTTTTTATTTAATTTGG - Intergenic
1034727060 7:153346165-153346187 ATGTATGCTTGGGTGTACTTTGG + Intergenic
1035247972 7:157577396-157577418 ATGCATGCTTTGATTCTGTTTGG - Intronic
1037011490 8:13848909-13848931 GTGGATGCTTACATTTACTTGGG + Intergenic
1037162787 8:15793202-15793224 ATGGATGATTGGATTGACTGAGG - Intergenic
1037670408 8:21010785-21010807 TTGCATGCTTGATTTAACTTTGG + Intergenic
1039286275 8:36044213-36044235 ATACATGCTTTGACTTACTATGG + Intergenic
1041098847 8:54376431-54376453 ATCCCTGCTTTGATTTATTTTGG + Intergenic
1043117309 8:76274421-76274443 ATACATGCTTGGGTTTATTTTGG - Intergenic
1046211985 8:111088032-111088054 ATGTATGTTGGTATTTACTTAGG + Intergenic
1046373000 8:113335890-113335912 GTGTATGCATGGATTTATTTTGG + Intronic
1046480642 8:114813224-114813246 ATAAATGCTTGGATTTATTCTGG - Intergenic
1046598306 8:116287310-116287332 ATGGATGATTGGATTTAATGTGG + Intergenic
1049190004 8:141282068-141282090 ATGCATCCTTCGATTTGCTCTGG - Intronic
1051514784 9:17916816-17916838 ATGCATGCGGGGATTTGATTAGG + Intergenic
1051854299 9:21545358-21545380 ATACATGCTTGTATGTACTTAGG - Intergenic
1052679863 9:31676407-31676429 ATGCATGCATGGATTTTCTTAGG - Intergenic
1052702564 9:31955632-31955654 ATATATGCTTGGGTTTACTTTGG - Intergenic
1052926868 9:34024398-34024420 ATGCATTCTTGGATGTCCTGAGG - Intronic
1054900622 9:70365353-70365375 ATGCATGCTAGGATTTTGATTGG - Intergenic
1055421582 9:76148899-76148921 ATGCACGGCTGGATTTACTCTGG - Intronic
1058126856 9:101205118-101205140 ATGCATGCTTTTATTTCTTTTGG + Intronic
1058167982 9:101642159-101642181 ATATATGCATGGATTTATTTTGG - Intronic
1058189185 9:101892131-101892153 ATGCATGTTTGCATGTTCTTTGG + Intergenic
1059279789 9:113122854-113122876 AGACATGCTTTGATGTACTTAGG + Intergenic
1062264999 9:135682987-135683009 ATTCATTCATTGATTTACTTGGG - Intergenic
1198719869 X:139604989-139605011 ATGCATGAATGTATTTATTTTGG - Intronic
1199127960 X:144146966-144146988 ATTCAAGCTTGGAATTTCTTAGG - Intergenic
1199293007 X:146125754-146125776 TTGCATGTTTTGATCTACTTGGG + Intergenic
1199414572 X:147566412-147566434 ATGCAAGATGGGATTTGCTTTGG - Intergenic
1199822348 X:151461992-151462014 CTGAAGGCTTGGATTTAATTTGG + Intergenic
1200642715 Y:5742060-5742082 AAGCATGCTTGGAACTGCTTTGG - Intronic
1201902746 Y:19060006-19060028 ATGCATGATTGGTTTAACATTGG + Intergenic