ID: 1027758495

View in Genome Browser
Species Human (GRCh38)
Location 7:82247585-82247607
Sequence CTGATTCAGCAATGCATGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027758495_1027758496 3 Left 1027758495 7:82247585-82247607 CCAAGCATGCATTGCTGAATCAG 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1027758496 7:82247611-82247633 GTGCTTTATCATGAAAACACAGG No data
1027758495_1027758497 28 Left 1027758495 7:82247585-82247607 CCAAGCATGCATTGCTGAATCAG 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1027758497 7:82247636-82247658 TGTTTTGATTTGATGACATCAGG 0: 1
1: 1
2: 1
3: 14
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027758495 Original CRISPR CTGATTCAGCAATGCATGCT TGG (reversed) Intronic
901414906 1:9109905-9109927 CTGACTCAGAAATGGCTGCTGGG + Intronic
903742139 1:25564506-25564528 GTGATTCTGCAATGGATCCTGGG - Intronic
904942796 1:34177011-34177033 CTGACTCGGCAAGGCAGGCTGGG - Intronic
906838338 1:49108588-49108610 CAGAGTGAGCAAAGCATGCTGGG + Intronic
908050429 1:60223983-60224005 CTGAGTAAGCCATGCATGCATGG + Intergenic
908144299 1:61221761-61221783 GTAATTGAGCAATGCATTCTGGG + Intronic
909872367 1:80758665-80758687 CTGATTCATCAGTACATGGTTGG + Intergenic
916861384 1:168809474-168809496 CTGATTCTGCCATGTATGGTTGG - Intergenic
920202331 1:204267251-204267273 CACATTCAACAATGCTTGCTAGG - Intronic
1064683999 10:17840207-17840229 CTGCTTAAGCAAAGCATCCTTGG + Intronic
1065839563 10:29690506-29690528 CTGCTTCTGAAATGTATGCTTGG - Intronic
1067981402 10:51089955-51089977 GTGATTCAGCAATGCATTTATGG + Intronic
1068248953 10:54410878-54410900 CTTATTCAACAATGCCAGCTCGG - Intronic
1078133987 11:8637240-8637262 CTTATTCACCAATGTATGCCTGG + Intronic
1079096284 11:17512542-17512564 CAGATTCAGAGATGCATCCTGGG + Intronic
1079904259 11:26224794-26224816 GGGCTTCAGCAATGTATGCTGGG + Intergenic
1080248558 11:30207323-30207345 CTTATTCTGCAATCCATACTGGG - Intergenic
1080452949 11:32393733-32393755 CTTCTTCTGCAATGCCTGCTTGG + Intronic
1081343230 11:41952793-41952815 GAGATTAAGCTATGCATGCTAGG - Intergenic
1084377637 11:68788957-68788979 CTGTTTGACCAATGCATGCAGGG + Intronic
1085675687 11:78515359-78515381 CTGATTCAGTAGTGTTTGCTAGG + Intronic
1087235195 11:95710296-95710318 CTGACTAAGCAATGGATGTTAGG + Intergenic
1087259166 11:95991610-95991632 CTGATTCAACAGTGATTGCTGGG + Exonic
1089959331 11:122601970-122601992 CAGATTCTGCAATTCATCCTTGG + Intergenic
1090563952 11:127965574-127965596 CTGATTCATCTATGTATCCTTGG + Intergenic
1093844164 12:23948496-23948518 CTGACTATGCAATGCAAGCTAGG - Intronic
1099956473 12:89355524-89355546 CTGATACAACAATGCATATTGGG + Intergenic
1101571009 12:105953769-105953791 CTGAATCAGCTTTGTATGCTAGG - Intergenic
1106116516 13:26822200-26822222 CTGAGCCAGCACAGCATGCTGGG - Intergenic
1108214766 13:48173271-48173293 ATGATTCAGCATTTTATGCTCGG + Intergenic
1115732282 14:36284385-36284407 CTGTTTCAGGAATGTATGCAGGG - Intergenic
1116014846 14:39394135-39394157 GTGATTCAGTAATGCATGAAAGG + Intergenic
1117998318 14:61499067-61499089 CTCATTAAGCCATGCATGTTAGG + Intronic
1118138871 14:63057517-63057539 CTTATTCACCAATGCATCCCTGG - Intronic
1119138553 14:72243797-72243819 CTGATTCAGCTATTCAGTCTGGG + Intronic
1124707275 15:31976412-31976434 CTGTTTCTGCACTGCATGCCTGG + Intergenic
1125145826 15:36467176-36467198 CTGAGAGAGCAATGCATGATTGG - Intergenic
1126565875 15:50098754-50098776 CTGAATCAGATATGCATACTGGG - Intronic
1126567536 15:50115435-50115457 CTGACTCTGCAAAGCAGGCTTGG - Intronic
1127317731 15:57813912-57813934 TTGATTCAGCTATGGATACTTGG + Intergenic
1128115088 15:65100363-65100385 CTGATTAAGCAACACACGCTTGG + Intronic
1128905394 15:71463498-71463520 CTGATTAATCAATACATTCTGGG + Intronic
1129307792 15:74680317-74680339 TTGAGTCAGCATTGCATCCTTGG - Intronic
1134231206 16:12432048-12432070 TTTATTCAGCAATGAGTGCTGGG + Intronic
1135408816 16:22217856-22217878 CTGATTCAGAAATCTACGCTGGG + Intronic
1135880429 16:26250339-26250361 CTTATTCAGCAATCCATGTTGGG - Intergenic
1144389526 17:14780410-14780432 CAGATTCAGAAATCCAGGCTTGG + Intergenic
1145727519 17:27145250-27145272 CTTATTCAACAATGCCAGCTCGG - Intergenic
1146261587 17:31425744-31425766 CTGCTTCTGCAATGCCTGCCAGG + Intronic
1147641530 17:42004487-42004509 CTGATTCACCAAGAGATGCTGGG + Intronic
1152844091 17:82588662-82588684 CTGTTTCAGAAATGCATTCTTGG - Intronic
1203161518 17_GL000205v2_random:56739-56761 CTGATACAGCAAATCCTGCTGGG + Intergenic
1155717607 18:28966010-28966032 CTGATCCAGCAATCCACCCTAGG + Intergenic
1158747044 18:60213058-60213080 CTAATACAGCAATGATTGCTTGG + Intergenic
1161443126 19:4303851-4303873 CTGATTCTGTAGTGCATTCTGGG + Intergenic
1166206963 19:41276488-41276510 TTGATGAAGCAATGCATGGTTGG - Intronic
926608802 2:14924474-14924496 CTGATAAATTAATGCATGCTGGG - Intergenic
926879231 2:17524084-17524106 CTGATTCGGCAATGTATTGTTGG - Intergenic
927550052 2:23990393-23990415 CTGATTCAGCCATGTAAACTTGG + Intronic
928109520 2:28495377-28495399 CTAAGTCAGGAATGCAGGCTGGG - Intronic
928366931 2:30710081-30710103 CTGCTTCAGCACTGCCTGCCAGG - Intergenic
933412520 2:81943968-81943990 TTGATTGAGTAATGCATACTTGG - Intergenic
937268290 2:120630996-120631018 CCGGTTCAGCTCTGCATGCTAGG + Intergenic
938405500 2:131030797-131030819 CTGAGTCTGCAGTGCAAGCTAGG - Intronic
940781262 2:157936590-157936612 CTGATTCAGCAATGGTAGCTGGG - Intronic
941077068 2:161017846-161017868 TTGATTCAGAACTGCATGTTGGG - Intergenic
947263849 2:228254219-228254241 CTGAGACAGCAATGCCTGCATGG + Intergenic
948940775 2:241195269-241195291 ATGAGACAGCAATGGATGCTGGG - Intronic
1168978123 20:1983086-1983108 CTGTCTCAGCAATTCCTGCTGGG + Exonic
1169559168 20:6780832-6780854 CTGATCCTGCCATGCATGATTGG + Intergenic
1172959425 20:38788032-38788054 GTGGCTCAGCAATTCATGCTGGG + Intergenic
1175043281 20:56076501-56076523 CTGATTAAGTGATGCATTCTGGG + Intergenic
1175534638 20:59700298-59700320 CTGATTCATCGATGAATGTTTGG - Intronic
1182615252 22:31584071-31584093 CAGATTCAGAAAGGCCTGCTGGG + Intronic
1183490965 22:38115453-38115475 CTGTGTCAGCAAACCATGCTAGG - Intronic
950103270 3:10371432-10371454 GTGAGTCAGCAATTCAAGCTGGG - Intronic
950316062 3:12003478-12003500 TGGATGCATCAATGCATGCTAGG + Intergenic
951353540 3:21636073-21636095 TTGATTCAGCAATCCATGACTGG - Intronic
954318249 3:49812930-49812952 CAGAATCAGAAAGGCATGCTGGG + Intronic
955008254 3:54989925-54989947 CTGAGCAAGCACTGCATGCTGGG - Intronic
955106897 3:55907072-55907094 CTGATTCACCACTGTGTGCTAGG - Intronic
955990991 3:64627221-64627243 CTGAGTCAGCAAAGCATGAAAGG - Intronic
964323668 3:155524074-155524096 CTCATCCATCAATGGATGCTTGG - Intronic
966875095 3:184316959-184316981 CTGGTGGAGCAGTGCATGCTGGG + Intronic
967165442 3:186775666-186775688 CTGATCCGTCAATGGATGCTTGG + Intergenic
971936282 4:33152191-33152213 TTGTTTCAGAAATGCATTCTGGG + Intergenic
972163624 4:36255930-36255952 TTCATTCAGCCATGAATGCTTGG + Intergenic
974884710 4:67804318-67804340 CAGATTCTGTAAGGCATGCTAGG + Intergenic
975467721 4:74728433-74728455 CTACTTCAGCATTGCATGTTAGG - Intergenic
976086812 4:81415390-81415412 CTGATCCAGTAATCCATTCTTGG + Intergenic
982091500 4:151883685-151883707 CTGATTCTACAAAGCATGCTTGG - Intergenic
984882172 4:184419663-184419685 CACATTCAGCGATGCTTGCTGGG - Intronic
985748117 5:1659290-1659312 CTGAGTCAGCACAGCCTGCTTGG - Intergenic
986183506 5:5416242-5416264 CTGATTCAGCAATCATTTCTTGG + Intergenic
986489189 5:8271904-8271926 CTGCTCCAGCAAAGCAAGCTGGG - Intergenic
988369434 5:30346806-30346828 CTCAGGCAGCAATGCATGATCGG + Intergenic
992495595 5:77290293-77290315 CTCTTTCAGCCATGCATACTGGG - Intronic
993065833 5:83096100-83096122 CTGAGTCACCAAGGCAGGCTTGG - Intronic
993172824 5:84441741-84441763 TTGAATCAGCATTGCATGCCTGG - Intergenic
993971642 5:94427236-94427258 CTGTTTTAGAAAAGCATGCTAGG + Intronic
994565497 5:101440992-101441014 ATGGTTCAGCAATGTATCCTAGG + Intergenic
996008343 5:118450887-118450909 CTGTCTCTGCAATGCTTGCTGGG + Intergenic
996592845 5:125167013-125167035 TTGAATCAGCCATGCATACTTGG - Intergenic
998019788 5:138759713-138759735 CTGTTTCAGGAATGCATTGTAGG + Intronic
998319108 5:141212331-141212353 CTGATTCAGCAGTGCAGTATAGG - Intergenic
998505521 5:142669047-142669069 CGGCATCAGCCATGCATGCTGGG - Intronic
1006696504 6:35934828-35934850 CTTATTCATCCATGCATGTTTGG - Intergenic
1006907671 6:37544094-37544116 CTGACTCAGGATTGCATCCTGGG + Intergenic
1008811455 6:55505869-55505891 CTCCTTCAGCAATTCATCCTTGG + Intronic
1009722036 6:67484719-67484741 TTTATGCAGGAATGCATGCTGGG + Intergenic
1014594927 6:123323589-123323611 CTGATTCTGCAATCCTTCCTTGG + Intronic
1016515824 6:144892407-144892429 TTTATTCAGAAATGCAAGCTAGG - Intergenic
1017622484 6:156313699-156313721 CGGATTGAGCAATGCAGGCTGGG + Intergenic
1019717804 7:2548401-2548423 CTGAATCAGCACTGCAGGCTGGG + Intronic
1020857124 7:13443005-13443027 TTGATTTAGTAATGCATACTTGG - Intergenic
1020944086 7:14578943-14578965 CTGAAGCAGCAGTGCATGGTGGG - Intronic
1021775885 7:24055158-24055180 CAGATTCAGCACTGAATTCTGGG + Intergenic
1024019884 7:45359089-45359111 CACATTCAGCATTCCATGCTGGG - Intergenic
1027722002 7:81755100-81755122 CTGATTCATTAATGAATGCTGGG + Intronic
1027758495 7:82247585-82247607 CTGATTCAGCAATGCATGCTTGG - Intronic
1027861599 7:83589863-83589885 GTGGCTCAACAATGCATGCTTGG + Intronic
1028293170 7:89093410-89093432 CAAATTCAGCATTCCATGCTGGG + Intronic
1031211799 7:118838475-118838497 CAGAGTCAGCAATGCAAGGTTGG - Intergenic
1032634369 7:133690468-133690490 CTGATGCAGCAGTGCCTCCTTGG + Intronic
1032737720 7:134708125-134708147 CTGATTTCACAATGCATGTTTGG - Intergenic
1032783074 7:135179679-135179701 CTACTTCAGCCATGAATGCTGGG - Intergenic
1033726292 7:144122014-144122036 CTGATTCTGCAAAGCACTCTTGG - Intergenic
1037338386 8:17814150-17814172 CTGTTTGAGCATTTCATGCTTGG - Intergenic
1037761595 8:21745330-21745352 CTGATACAGCCAGGCCTGCTTGG - Intronic
1040338593 8:46428574-46428596 CTGATACAGCAGGGAATGCTGGG + Intergenic
1040384464 8:46904867-46904889 CTGACTCAGCTACTCATGCTGGG + Intergenic
1046805215 8:118472788-118472810 CTGAGTCAGCAATGTATACCAGG - Intronic
1047806849 8:128370102-128370124 GTTATTAAGCAATGCATTCTTGG + Intergenic
1056863711 9:90210989-90211011 CAGATTCGGCAATGCTTTCTGGG + Intergenic
1057008135 9:91578702-91578724 CTGATTCAAAATTGCATCCTGGG + Intronic
1057322454 9:94027007-94027029 CTGACTCAGCAATTCACTCTGGG + Intergenic
1058543633 9:106038099-106038121 CTGTTTCATAAATGCATGCCAGG - Intergenic
1187502684 X:19852845-19852867 ATGAGTCAGGAATGCATGATCGG + Intronic
1189627200 X:42911510-42911532 ACGATTCAGCAATCCCTGCTGGG + Intergenic
1192078410 X:68023632-68023654 CTCCTTCAGCAGTGCATGCAGGG + Intergenic
1193220745 X:78923388-78923410 CTCATTCACCAATGTATACTGGG - Intergenic
1195530260 X:105945868-105945890 CTGATTGATCAATGCATACTTGG - Exonic
1195762121 X:108257790-108257812 CTCATACAGCAAAGCATGATTGG - Intronic
1198680759 X:139179788-139179810 CTTACTCAGCATTGGATGCTGGG - Intronic