ID: 1027758496

View in Genome Browser
Species Human (GRCh38)
Location 7:82247611-82247633
Sequence GTGCTTTATCATGAAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027758495_1027758496 3 Left 1027758495 7:82247585-82247607 CCAAGCATGCATTGCTGAATCAG 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1027758496 7:82247611-82247633 GTGCTTTATCATGAAAACACAGG No data
1027758494_1027758496 14 Left 1027758494 7:82247574-82247596 CCAAAGTAAATCCAAGCATGCAT 0: 1
1: 0
2: 4
3: 21
4: 180
Right 1027758496 7:82247611-82247633 GTGCTTTATCATGAAAACACAGG No data
1027758493_1027758496 28 Left 1027758493 7:82247560-82247582 CCACTGAGGTCTGTCCAAAGTAA 0: 1
1: 0
2: 1
3: 13
4: 123
Right 1027758496 7:82247611-82247633 GTGCTTTATCATGAAAACACAGG No data
1027758492_1027758496 29 Left 1027758492 7:82247559-82247581 CCCACTGAGGTCTGTCCAAAGTA 0: 1
1: 0
2: 3
3: 11
4: 109
Right 1027758496 7:82247611-82247633 GTGCTTTATCATGAAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027758496 Original CRISPR GTGCTTTATCATGAAAACAC AGG Intronic
No off target data available for this crispr