ID: 1027759553

View in Genome Browser
Species Human (GRCh38)
Location 7:82260755-82260777
Sequence TTGATGTCATTGTTAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 405}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027759553_1027759555 -9 Left 1027759553 7:82260755-82260777 CCTGTTTTTAACAATGACATCAA 0: 1
1: 0
2: 3
3: 31
4: 405
Right 1027759555 7:82260769-82260791 TGACATCAAAAATATCTCAAGGG No data
1027759553_1027759557 10 Left 1027759553 7:82260755-82260777 CCTGTTTTTAACAATGACATCAA 0: 1
1: 0
2: 3
3: 31
4: 405
Right 1027759557 7:82260788-82260810 AGGGGAATATTAGTTCCAAAAGG 0: 1
1: 0
2: 0
3: 20
4: 183
1027759553_1027759554 -10 Left 1027759553 7:82260755-82260777 CCTGTTTTTAACAATGACATCAA 0: 1
1: 0
2: 3
3: 31
4: 405
Right 1027759554 7:82260768-82260790 ATGACATCAAAAATATCTCAAGG 0: 1
1: 0
2: 3
3: 38
4: 367
1027759553_1027759556 -8 Left 1027759553 7:82260755-82260777 CCTGTTTTTAACAATGACATCAA 0: 1
1: 0
2: 3
3: 31
4: 405
Right 1027759556 7:82260770-82260792 GACATCAAAAATATCTCAAGGGG 0: 1
1: 0
2: 3
3: 24
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027759553 Original CRISPR TTGATGTCATTGTTAAAAAC AGG (reversed) Intronic
903699597 1:25236890-25236912 TTTGTGTGATTTTTAAAAACTGG + Intergenic
903731428 1:25498579-25498601 CTGTTGTCATTTTTAAAAAGGGG + Exonic
905034483 1:34908578-34908600 ATGATGTCATTATTAGACACAGG + Intronic
906373632 1:45275671-45275693 GTGATTTTATTGTTGAAAACTGG - Intronic
906979165 1:50609686-50609708 ATGATGTCATTTTTAAAAGCTGG - Intronic
907297423 1:53464299-53464321 TTGCTGTAATTATGAAAAACAGG - Intronic
908180274 1:61597019-61597041 CTGACTTCTTTGTTAAAAACTGG - Intergenic
909016083 1:70381269-70381291 GTGATGTCATTGTAATATACTGG - Intronic
909248283 1:73318480-73318502 TTGATATCATTGTTGATAAATGG - Intergenic
910181971 1:84494347-84494369 TTGATGCCATTGTAAAAAGATGG + Intronic
911366171 1:96940536-96940558 TTGATGTCATGGTATAAAAGTGG + Intergenic
911737489 1:101353730-101353752 ATGATGTTATGGATAAAAACTGG - Intergenic
911789951 1:102001639-102001661 TTTCTGTCTGTGTTAAAAACTGG + Intergenic
912049705 1:105511401-105511423 TTGCTGTCATTCTTTAAAACTGG - Intergenic
913541536 1:119825850-119825872 TTAATATCATTTTTAAAAAGTGG + Intergenic
913733620 1:121746640-121746662 TTGAGGCCATTGTTGGAAACGGG + Intergenic
913733861 1:121751056-121751078 TTGAGGCCATTGTTGGAAACGGG + Intergenic
913902790 1:124531144-124531166 TTGAGGCCATTGTTGGAAACGGG + Intergenic
913934576 1:125022031-125022053 TTGAGGTCTTCGTTGAAAACGGG + Intergenic
913941518 1:125112662-125112684 TTGATGTCATATATATAAACAGG - Intergenic
915003814 1:152618355-152618377 TTAATTTCATTTTTAAAAAGTGG + Intergenic
917026478 1:170648352-170648374 TTGAGGTCAGTGTGAACAACTGG + Intergenic
917875242 1:179280707-179280729 TTGTTGTCGTTGTTGAAAACTGG + Intergenic
918409803 1:184246653-184246675 TTGAGTTCATTGTAAAAAAAAGG + Intergenic
919285151 1:195549148-195549170 TGGAAGACATTGTTAAGAACTGG - Intergenic
919359226 1:196569370-196569392 ATGAGGTCATTTTTAAAAATAGG - Intronic
920452437 1:206069823-206069845 TTCATGTAATTTTTAAAAATAGG - Intronic
923911742 1:238454402-238454424 TTGTTATGATTGTTAACAACAGG - Intergenic
924062345 1:240187988-240188010 CTCATGTCATTTTTAAAAATTGG - Intronic
924067257 1:240236681-240236703 GAGATGTGATTGTTAAAAAGAGG - Intronic
924727273 1:246682483-246682505 TAGACGTAATTGTTGAAAACAGG - Intergenic
1064894945 10:20224718-20224740 TTGATTTCATTATTCAAAATTGG + Intronic
1066931409 10:41764688-41764710 TTGAGGTCAATGTCAAAAAAGGG + Intergenic
1066954891 10:42156422-42156444 TTGATGTCATATATATAAACAGG + Intergenic
1067955931 10:50790424-50790446 TTGATGTCAATGATTAAAAATGG + Intronic
1068238421 10:54270186-54270208 TGGATCCCATTTTTAAAAACTGG - Intronic
1068793606 10:61053544-61053566 TTGATGTCAAAGTTGCAAACTGG + Intergenic
1069320081 10:67158965-67158987 TTGTTGTTTTTTTTAAAAACAGG - Intronic
1071652756 10:87410355-87410377 TGGATCCCATTCTTAAAAACTGG - Intergenic
1071699398 10:87914158-87914180 TTGTTGTTGTTGTCAAAAACTGG + Intronic
1071778059 10:88811160-88811182 TTGTTGTTATTGCTATAAACGGG - Intronic
1071970633 10:90902636-90902658 TTGTTGTCATTTTAAAAATCAGG - Intronic
1072170745 10:92859132-92859154 TTGTTATTATTGTTGAAAACTGG + Intronic
1073766321 10:106686547-106686569 TTGGTGGCATTTTAAAAAACAGG - Intronic
1073940584 10:108693544-108693566 TTGTTGTTGTTGTTGAAAACTGG - Intergenic
1074656170 10:115590316-115590338 TTAAGATCATTATTAAAAACAGG - Intronic
1074670308 10:115782978-115783000 TTGAAGACATTGTTTAAAACAGG - Intronic
1074877848 10:117628204-117628226 TAGATGTCATTCTTAGAATCAGG - Intergenic
1076003223 10:126928668-126928690 GTGATGTCCTTGTTAAGAAGAGG + Intronic
1077856440 11:6130981-6131003 GTGGGGTCACTGTTAAAAACAGG - Intergenic
1077870150 11:6255266-6255288 TAGAGGTCATTATTAAAGACTGG - Intergenic
1080360961 11:31513041-31513063 TTGACATCAATGTTAAAAAATGG - Intronic
1081076849 11:38686325-38686347 TTGCTTTCTTTATTAAAAACTGG + Intergenic
1082082054 11:48019692-48019714 TTGATTTGCTTTTTAAAAACTGG + Intronic
1082210485 11:49495677-49495699 TTGATGTCCTTATAAAAAAAGGG - Intergenic
1082603292 11:55189415-55189437 TTGAGGCCAATGTTAAAAAAGGG - Intergenic
1083551228 11:63591551-63591573 CGGATGTCATTGTTGAAGACTGG - Intronic
1085000602 11:73030012-73030034 TTGTTGTTGTTGTTAAAAACTGG - Intronic
1085731115 11:78999644-78999666 TTGATTTTGTTGTTGAAAACTGG - Intronic
1085844560 11:80050464-80050486 TTGTTATCATTGTTAACAAGAGG - Intergenic
1086850666 11:91803515-91803537 TTAATGTCATTATTATAAATTGG + Intergenic
1087285725 11:96263258-96263280 TGCCTGTCATTGTTAAAAGCAGG + Intronic
1087452198 11:98339144-98339166 TTGATATCAATTTTCAAAACGGG - Intergenic
1088126421 11:106430309-106430331 TTCATGTCATTATTTTAAACTGG + Intergenic
1088234349 11:107706412-107706434 TTGATGTGATTGTGAATTACTGG - Intergenic
1088843552 11:113646596-113646618 TTGTTTTCATTTTTAAAAGCAGG - Intergenic
1093333695 12:17874613-17874635 TTGATGACATTGTGAAAATTTGG - Intergenic
1093504860 12:19853464-19853486 TTTATTGCATTGCTAAAAACAGG - Intergenic
1094244016 12:28266069-28266091 TAGGCGTCATTTTTAAAAACTGG - Intronic
1094322613 12:29202042-29202064 TTGATATAATTTTTAAAAAGAGG + Intronic
1094935755 12:35679308-35679330 TTGAGGTCTTCGTTGAAAACGGG + Intergenic
1095016581 12:36987004-36987026 TTGAGGTCTTTGTTGGAAACGGG + Intergenic
1095025382 12:37129317-37129339 TTGAGGTCTTTGTTGGAAACGGG + Intergenic
1095311048 12:40697268-40697290 TTGATATTATTTTTAAAAATTGG + Intronic
1095499656 12:42822777-42822799 TTGGTGCCTTTGTCAAAAACTGG + Intergenic
1095792098 12:46178597-46178619 ATGATGTCCTTGTTGAACACCGG - Intergenic
1095857150 12:46872851-46872873 TTGATGTCACCTTTGAAAACAGG - Intergenic
1096186919 12:49587493-49587515 ATGAGGTCATTGTTAAAGCCTGG + Exonic
1096609893 12:52794210-52794232 TTGATGTGATTCTCAAAAAGAGG + Exonic
1098101899 12:67026926-67026948 TTGTTGTTGTTGTTTAAAACTGG + Intergenic
1099225248 12:79961236-79961258 TTGATGTCATTAGAAAATACCGG - Intergenic
1099420601 12:82454485-82454507 TTCCTGTTATTGCTAAAAACAGG + Intronic
1100031890 12:90202645-90202667 TTTATGTCATCTTTTAAAACTGG - Intergenic
1101454152 12:104812361-104812383 TTGCTATGATTTTTAAAAACAGG + Intronic
1104259288 12:127167760-127167782 TTCATTTCATTTTTAAAAATTGG - Intergenic
1105162580 13:17458014-17458036 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105165247 13:17499981-17500003 TTGATGCCTTTGTTGAAAAAGGG + Intergenic
1105165299 13:17500834-17500856 TTGATGCCTTTGTTGAAAAAGGG + Intergenic
1105165466 13:17503386-17503408 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105165926 13:17510697-17510719 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105167629 13:17537561-17537583 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105168880 13:17557285-17557307 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105170674 13:17585500-17585522 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105171747 13:17602148-17602170 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105183494 13:17784863-17784885 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105186399 13:17830223-17830245 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105191160 13:17904019-17904041 TTGATGTCTTTGGTGAAAAAGGG + Intergenic
1105194345 13:17953299-17953321 TTGATGCCTTTGGTAAAAAAGGG + Intergenic
1107593105 13:41929623-41929645 TTGATGCCCTTGTCAAAAATTGG - Intronic
1107657196 13:42603828-42603850 TTGATGTAATTCTTAATTACGGG + Intronic
1108615325 13:52127182-52127204 ATGATCTCATTTTTAAAAAGAGG - Intronic
1108829809 13:54463678-54463700 GTGTTTTCATTTTTAAAAACTGG - Intergenic
1109131808 13:58596363-58596385 TTCATTTCATTGTTACAAAAGGG - Intergenic
1109703108 13:66052824-66052846 TTGATGTTAGGTTTAAAAACAGG - Intergenic
1110017919 13:70432414-70432436 GTGATGTCAGTGTTGAAAACAGG + Intergenic
1111345045 13:86940763-86940785 TTTATGTCATTGCAAAAGACGGG - Intergenic
1111372819 13:87338555-87338577 TTAATGTCATTTTTACAAAATGG + Intergenic
1111903040 13:94223087-94223109 TTGTGGTCATTTTTAAAAATAGG - Intronic
1112425556 13:99295966-99295988 TGGTCGTCATTGTTCAAAACAGG - Exonic
1113170604 13:107498417-107498439 TTCCTGTCATTGTTAAAAAATGG + Intronic
1113232370 13:108227013-108227035 TGGAAGTCATTTTTAAGAACAGG - Intronic
1114056661 14:18974540-18974562 TTGCTGTCGTTGTTAGAGACAGG - Intronic
1114105888 14:19427187-19427209 TTGCTGTCGTTGTTAGAGACAGG + Intronic
1115707279 14:36012384-36012406 TTGATTTAATTGTTGAAAACAGG + Intergenic
1115724628 14:36199509-36199531 ATGATTTGATTGCTAAAAACTGG + Intergenic
1117484698 14:56182670-56182692 TTAATGTCATTGCTACAACCAGG + Intronic
1117660122 14:57995444-57995466 TCTCTGTCATTGTTAAAAAGAGG - Intergenic
1118074037 14:62279279-62279301 TTGATGACATAGTAAAAAATTGG + Intergenic
1118742583 14:68750882-68750904 TTTATCACATTTTTAAAAACTGG + Intergenic
1119054178 14:71402257-71402279 TTGATGGCATTGTATAAAAAAGG + Intronic
1119056531 14:71427962-71427984 TTGTTGTTGTTGTTGAAAACTGG + Intronic
1119773032 14:77233285-77233307 CTGATGTCTTTGTTAAAAGTTGG + Intronic
1120341146 14:83222455-83222477 TTGTGGTTGTTGTTAAAAACTGG + Intergenic
1120400833 14:84029288-84029310 TCTATCTCATAGTTAAAAACTGG + Intergenic
1120587491 14:86331415-86331437 TTGATGCCATTCTTAAAGAGAGG + Intergenic
1120769575 14:88364365-88364387 TTAATTTTATTGTTAAAAGCAGG - Intergenic
1120905959 14:89621531-89621553 TTGATCCCTTTGTTGAAAACTGG + Intergenic
1121110967 14:91312805-91312827 TTGATGTCATACTTACACACAGG - Intronic
1124362418 15:29047359-29047381 TTGTAGTCATGGTGAAAAACGGG + Intronic
1124582839 15:30976506-30976528 TTTATGTCATTTTTATAAGCAGG + Intronic
1125626668 15:41115169-41115191 TTGATGTACTTGTTAGAAATGGG - Intronic
1125804291 15:42479532-42479554 TTGATGTTTTTTTTAAAGACAGG + Intronic
1126482985 15:49147562-49147584 ATTATAACATTGTTAAAAACAGG + Intronic
1128375210 15:67069403-67069425 TTGATTCCATTCTTATAAACTGG - Intronic
1128962564 15:72022859-72022881 TTGTTGTTGTTGTTGAAAACTGG - Intronic
1129355597 15:74988774-74988796 GTAATGTCATTTTTAAAAATTGG - Intronic
1130733484 15:86523545-86523567 TAGTAGTCATTGGTAAAAACTGG + Intronic
1131034588 15:89213509-89213531 TTGTTGTCATTGCTAAAAATGGG - Intronic
1133004484 16:2871251-2871273 TTGATGTCATTTTAAATCACTGG - Intergenic
1133276871 16:4643820-4643842 TTCTTGTTATTGATAAAAACTGG - Intronic
1134329497 16:13237356-13237378 AAGATCTCATTTTTAAAAACAGG - Exonic
1134586267 16:15414104-15414126 TTGATTTCATAGTAAAAATCTGG + Intronic
1135145711 16:19961044-19961066 TTGAAACCATTTTTAAAAACTGG - Intergenic
1135198747 16:20418439-20418461 ATGATGTAATTGATAAAAGCAGG + Intronic
1136697037 16:32091460-32091482 TTGATGTCATATATATAAACAGG + Intergenic
1136797536 16:33034750-33034772 TTGATGTCATATATATAAACAGG + Intergenic
1137084934 16:36108157-36108179 TTGATGTCATATATATAAACAGG + Intergenic
1139119525 16:63998596-63998618 TTGCTGTTGTTGTTAGAAACTGG - Intergenic
1140150094 16:72354185-72354207 TTTTTGTTATTTTTAAAAACAGG - Intergenic
1144694999 17:17297619-17297641 TTGGTATTATTATTAAAAACAGG + Intergenic
1145052516 17:19674074-19674096 TTGTTTTCATTTTTAAAAAAAGG + Intronic
1145325662 17:21821976-21821998 TTGAAGTCATTCTAAAAATCAGG - Intergenic
1145687056 17:26680206-26680228 TTGATGCCATCGTTGGAAACGGG + Intergenic
1145689642 17:26725518-26725540 TTGATGTCATATATATAAACAGG - Intergenic
1145693507 17:26767792-26767814 TTGATGTCATATATATAAACAGG - Intergenic
1145722443 17:27086776-27086798 TTGGTGCCTTTGTTAAAAATAGG - Intergenic
1146775454 17:35610446-35610468 TTTATGTAATTTTTAAAAAGGGG - Intronic
1147504708 17:41004315-41004337 TTGAAATCATTGTTCAAAACAGG + Intergenic
1148056422 17:44799616-44799638 TTAATATCATTATTAAAAACAGG + Exonic
1149062776 17:52442941-52442963 TTTATATAAATGTTAAAAACGGG - Intergenic
1149087787 17:52740060-52740082 TTGAAGTCTTTGCTAAAGACAGG + Intergenic
1149732277 17:58958123-58958145 TTGTTGTCATTGTTTGAGACAGG - Intronic
1150236052 17:63593409-63593431 TGGATGTCATTTTTAAAATATGG + Exonic
1150544068 17:66135240-66135262 TTGGTATCATTGTTAAAATCTGG + Intronic
1152121003 17:78418251-78418273 TTAATTTCATATTTAAAAACAGG - Intronic
1203190857 17_KI270729v1_random:186945-186967 TTGATGTCATATATATAAACAGG - Intergenic
1153731940 18:8022739-8022761 TTGAAGTCATTGATAAGGACAGG - Intronic
1155559357 18:27059255-27059277 TTAATGTCATTGTTTCAAATGGG - Intronic
1155790613 18:29964848-29964870 TTGTTGCCATTTTTAAAAATAGG - Intergenic
1156077343 18:33296458-33296480 TTGTTGTCAGTATTAAAACCAGG - Intronic
1156256203 18:35399114-35399136 TTGTTCTCATTGCTAATAACTGG - Intergenic
1156379196 18:36542068-36542090 TTAATTCCATTGTTATAAACCGG - Intronic
1156863441 18:41864379-41864401 TAGATGGCTTTGTTAAATACTGG - Intergenic
1157821416 18:50773624-50773646 TTGATGCCTTTGTCAAAAATTGG - Intergenic
1158753359 18:60292381-60292403 CTAATGTAATTGTTAAAAGCAGG + Intergenic
1159091630 18:63855693-63855715 TTGTTGTTGTTGTTAGAAACGGG + Intergenic
1159442638 18:68501064-68501086 TTAATATCATTGATAAAAAAAGG + Intergenic
1159755596 18:72360101-72360123 TTGATGATCTTGTTAAAAGCAGG - Intergenic
1160066872 18:75583768-75583790 TTAAAGTCATTATTAAAAAGAGG + Intergenic
1160115129 18:76072046-76072068 TTGATGCCATTGTGAGAAATAGG - Intergenic
1160618183 18:80149837-80149859 TTGCTGTCATTGTTGAAATTAGG + Intronic
1162290702 19:9778011-9778033 TTGAGATTTTTGTTAAAAACTGG - Intronic
1162611373 19:11756892-11756914 TTTATGTCTTTGTAGAAAACTGG + Intergenic
1162857248 19:13478325-13478347 TTGCTGTCATTTTTACAGACAGG + Intronic
1164346127 19:27260518-27260540 TTGAGGCCTTTGTTAGAAACGGG + Intergenic
1164346512 19:27268678-27268700 TTGAGGTCTTTGTTGGAAACGGG + Intergenic
1164567966 19:29342117-29342139 TTGTTGTTGTTGTTGAAAACTGG - Intergenic
1202669085 1_KI270709v1_random:33384-33406 TTGATGTCATATATATAAACAGG - Intergenic
925506549 2:4571858-4571880 TTGATGTGGTTGTATAAAACTGG + Intergenic
925841085 2:7993065-7993087 TTTATGTCAATGCTAAAACCAGG + Intergenic
926307716 2:11651080-11651102 TTGATGTCAGTGTTATTACCAGG + Intergenic
926447396 2:12960455-12960477 TTGTTGTTGTTGTTGAAAACTGG + Intergenic
926552696 2:14319221-14319243 TTTTTGCCATTGTGAAAAACAGG - Intergenic
928372143 2:30747962-30747984 TTGATGTCATTTTAAAAATGGGG + Intronic
929716103 2:44311456-44311478 TTGTTGTTGTTGTTAAAAACCGG + Intronic
930635503 2:53800841-53800863 TTGCTGTTAATATTAAAAACGGG + Intronic
930660534 2:54048486-54048508 TTGATTTAATTTTTAAAAAGTGG - Intronic
932947612 2:76255217-76255239 AGGATGTTAATGTTAAAAACTGG - Intergenic
933862252 2:86481947-86481969 TTGATTTCATTCTTTAAAATTGG - Exonic
934470820 2:94532427-94532449 TTGAGGCCTTTGTTAGAAACGGG - Intergenic
935290414 2:101605826-101605848 TTGGTATCATTGTCAAAAACAGG - Intergenic
936727565 2:115339287-115339309 TTGATGTCATTAAAAAAAAATGG - Intronic
937472660 2:122187380-122187402 TTGATGTCATTATTACAATGTGG - Intergenic
937619864 2:123973013-123973035 TTGATCTCATTGGAAAAAAATGG + Intergenic
937764818 2:125648829-125648851 TTGTTGTTGTTGTTGAAAACAGG + Intergenic
939563746 2:143762365-143762387 TTCATTTCTTTGCTAAAAACAGG + Intronic
940009311 2:149038214-149038236 TTAATGTCATTATTTAAAAAGGG + Intronic
940200867 2:151149134-151149156 TTCATGTCATACTTCAAAACAGG + Intergenic
940525034 2:154802249-154802271 TTTATGTCACTGTAAACAACTGG - Intronic
940687781 2:156875481-156875503 TAGATTTCAGTGTTGAAAACTGG - Intergenic
940857224 2:158738946-158738968 TTGATGACAAGGTTAGAAACTGG - Intergenic
940938507 2:159528361-159528383 ATGTAGTCTTTGTTAAAAACAGG + Intronic
941008136 2:160268651-160268673 ATGTTTTCATTGTTGAAAACTGG + Intronic
941993320 2:171577749-171577771 TTAATGTCATTGTTGAATATTGG + Intergenic
943366723 2:186973608-186973630 TTGTTGTCATTGCCAAAAATGGG - Intergenic
943593327 2:189825706-189825728 TGGATGTCATTGATAAAAGAAGG + Intronic
943737923 2:191377796-191377818 TTGATGGCATTGTTCAAATTTGG - Intronic
945231866 2:207599250-207599272 GATATGTCATTTTTAAAAACTGG + Exonic
946437552 2:219667825-219667847 TTTATGTCACTGTTATAAAAGGG - Intergenic
947149988 2:227105726-227105748 TTTTTGTCATAGTTAAGAACAGG + Intronic
947157431 2:227176610-227176632 TTGAACTCATTTTTAAACACTGG - Intronic
947163450 2:227237560-227237582 CTGCTGTCATAGTTAAAAAGTGG - Intronic
948798209 2:240417440-240417462 TTGATTTCATTGGTTAAATCTGG + Intergenic
948881418 2:240859279-240859301 TGGATGGCATTCTTCAAAACTGG + Intergenic
1168954129 20:1822435-1822457 TTGTTGTTGTTGTTGAAAACTGG - Intergenic
1169209304 20:3756774-3756796 TTGTTTTCATTGTTATAAATAGG - Intronic
1171861043 20:30404076-30404098 TTAAAGTGATTATTAAAAACTGG - Intergenic
1172989860 20:39026804-39026826 TTGGAGTCATTGATAGAAACAGG + Intronic
1173772360 20:45672510-45672532 ATGATCTCATTTTTAAAAATAGG - Intergenic
1174078315 20:47953538-47953560 TTGATGCCATTGTGGACAACAGG + Intergenic
1174497349 20:50957827-50957849 TTGGTGTGATTGTTAGAACCGGG - Intronic
1177665182 21:24147415-24147437 TTGAAGTCATTTTTAAGAAGTGG + Intergenic
1177927905 21:27241947-27241969 TTGATGCCACTGTGAACAACTGG + Intergenic
1178144147 21:29718504-29718526 TTTATGACATTGTTAATAATGGG + Intronic
1178208446 21:30498385-30498407 TTGAAGCTGTTGTTAAAAACTGG - Intergenic
1179031584 21:37724965-37724987 TTTCTGTCATGGTTAAAAAAAGG - Intronic
1182378290 22:29864989-29865011 TTGTTGTTGTTGTTAAAGACAGG + Intergenic
1203325558 22_KI270738v1_random:11967-11989 TTGATGTCATATATATAAACAGG + Intergenic
949355543 3:3176852-3176874 TTGCTGTCATTGGTAACATCTGG - Intronic
950279256 3:11692465-11692487 TTGATGTCATTGTTCACAAAAGG + Intronic
950730158 3:14948981-14949003 ATGGTGTTATTGTTAAAAATGGG + Intronic
951065746 3:18263266-18263288 TTGTTGTCATTGTTAAGAACTGG + Intronic
951657410 3:25025171-25025193 TTGATGTCCTTCTGAAATACAGG + Intergenic
952619249 3:35316557-35316579 TTGTTGTTGTTGTTAAAAATTGG - Intergenic
952638472 3:35561169-35561191 GTGATGTCATTGTCTATAACTGG - Intergenic
952729759 3:36626420-36626442 TGGATGTCTGTGTTTAAAACTGG + Intergenic
953294070 3:41695604-41695626 ATGAAGTCATTGATAAAAACAGG + Intronic
953309930 3:41866761-41866783 CTGTTATCATTATTAAAAACTGG + Intronic
953479456 3:43237836-43237858 ATGATGTCAATGTTGAACACTGG + Intergenic
955602330 3:60659846-60659868 TTGTTGTTGTTGTTGAAAACCGG + Intronic
956269446 3:67434507-67434529 TTGTTGTTATTGTTAGAGACAGG - Intronic
957862896 3:85980424-85980446 TTGATGTCATTATTAAAAAATGG - Intronic
958209373 3:90450295-90450317 TTGAGGTCTTTGTTAAAAACGGG - Intergenic
958214577 3:90546000-90546022 TTGAGGTCTTCGTTGAAAACGGG - Intergenic
958219127 3:90639251-90639273 ATGAGGTCATTGTTGGAAACAGG - Intergenic
958619106 3:96533588-96533610 TTTCTGTTATTGTTGAAAACTGG - Intergenic
958686295 3:97401199-97401221 TTGATGTGATAGTTAAAAATTGG + Intronic
959508618 3:107183384-107183406 TTGATTTCATTGGTGAAAATGGG - Intergenic
959809910 3:110604286-110604308 TTGTTGTTGTTGTTGAAAACTGG - Intergenic
960798782 3:121516268-121516290 TTCATGTGATTTTTAAAAATTGG - Intronic
961420599 3:126800032-126800054 TTGATTTTAATATTAAAAACAGG - Intronic
961995774 3:131240538-131240560 TTGTTGTTGTTGTTAGAAACAGG + Intronic
962132390 3:132695416-132695438 TTTATATTATTTTTAAAAACTGG - Intronic
962185970 3:133259778-133259800 TGGGTGTGATTCTTAAAAACAGG + Intronic
964046647 3:152336275-152336297 TTGTTTAGATTGTTAAAAACTGG + Intronic
964054927 3:152442542-152442564 TTAATCTCATAATTAAAAACAGG - Intronic
964164948 3:153692056-153692078 CTGATGTTATTGTTGAGAACTGG - Intergenic
964314613 3:155429992-155430014 TGGAAGTCATATTTAAAAACTGG + Intronic
964329795 3:155589775-155589797 CTGCTGTCATTGCTAAAAAGAGG - Intronic
964623091 3:158734490-158734512 CTGATGGCATTGTTGAACACAGG + Intronic
965121657 3:164566540-164566562 TTGATGACATTATTAAAGAAGGG + Intergenic
965407416 3:168287450-168287472 TTGAGGCCATTGACAAAAACTGG + Intergenic
965730024 3:171761788-171761810 TTGTTGTGATTCATAAAAACTGG - Intronic
968289449 3:197527378-197527400 TTGATATCCTTGATAAAAGCTGG + Intronic
969931481 4:10635073-10635095 TTGATGACATTTTTACTAACTGG + Intronic
970208011 4:13675523-13675545 TTGAGGTTAGTGTTGAAAACTGG - Intergenic
970667076 4:18349173-18349195 TTGATGTCTTTGTCAAAGATTGG + Intergenic
970965190 4:21919933-21919955 TTTATGTTATAGTTAAAAAAAGG + Intronic
971625261 4:28911424-28911446 TTTATGTCCTTGTTATAAAAGGG + Intergenic
971722708 4:30267099-30267121 TTGATATCATTTTTTAAAATAGG - Intergenic
972924412 4:43985479-43985501 GTGAGGTAATTGTTAGAAACTGG + Intergenic
973781214 4:54289882-54289904 TTGAAGTTATTGTTGAAAATAGG + Intronic
974755145 4:66195759-66195781 TTGATGCCTTTATTATAAACTGG - Intergenic
975168949 4:71211530-71211552 TTGAGGTCACTCCTAAAAACTGG - Intronic
975272494 4:72452082-72452104 TTGTTGTTATTGTTTGAAACTGG - Intronic
976469129 4:85406942-85406964 CTGATGGAATTGTTACAAACTGG - Intergenic
977447337 4:97147719-97147741 TGTATGTCATTTTGAAAAACTGG - Intergenic
977484704 4:97627841-97627863 TTGATGTAATTCTGAGAAACGGG + Intronic
978114556 4:105003728-105003750 TGGAAGTCATTGATAATAACAGG + Intergenic
978648159 4:110966860-110966882 TTGTTAACATTGTTTAAAACTGG + Intergenic
979325220 4:119371311-119371333 ATGTTGTCATTTTGAAAAACAGG - Intergenic
979397882 4:120210394-120210416 ATGATGTCATTTTTAATCACAGG + Intergenic
979833322 4:125328657-125328679 TTTATGTTATTGTTAGACACTGG + Intronic
980312647 4:131153575-131153597 TTGTTGTTATTGTTGAAAAAGGG - Intergenic
980428712 4:132661685-132661707 TTGATGTTTTTGTTAATAATTGG - Intergenic
980956587 4:139434787-139434809 TTTATTTCAATGTTTAAAACTGG + Intergenic
981056407 4:140366756-140366778 TAGATGTTATTGATCAAAACAGG - Intronic
981294369 4:143114341-143114363 TTGATTTCATTTTTAATAATTGG - Intergenic
981779973 4:148417733-148417755 TTTATATTATTGTTAAACACTGG - Intronic
982186254 4:152803630-152803652 TTGATGCCATTTTCAACAACAGG + Intronic
982718703 4:158837335-158837357 GTGATGTCAGTGTTCAGAACGGG - Intronic
983086099 4:163446424-163446446 TTGATGTCATTGTAAAGATGAGG + Intergenic
983243124 4:165256329-165256351 ATGTTGTCATTTTGAAAAACGGG - Intronic
983335695 4:166389039-166389061 TTGGTATCATTCTAAAAAACCGG - Intergenic
983462431 4:168044744-168044766 TTAATTTCACAGTTAAAAACTGG + Intergenic
983782556 4:171689605-171689627 TTAATGTCATTATTACAAGCAGG - Intergenic
984585146 4:181555085-181555107 TTATTGTCATTATTAATAACAGG - Intergenic
986749020 5:10769086-10769108 TTTTTCTCATAGTTAAAAACAGG + Intergenic
988044604 5:25934083-25934105 TTGATGTTATGGTTAAAAGAAGG - Intergenic
988048118 5:25986191-25986213 TTGGTGTCATTGTCAAAGACTGG + Intergenic
989406389 5:41065764-41065786 TTGATTGCACTTTTAAAAACTGG - Intronic
989853154 5:46241588-46241610 TTGAGGCCATTGTCAAAAAAGGG - Intergenic
989908521 5:47297730-47297752 TTGATGTCAATGGTAGAAAAGGG + Intergenic
990444151 5:55878425-55878447 TTGTTGTTGTTGTTAAAAATTGG + Intronic
991301844 5:65135994-65136016 TTGCTGTCAGTATTAAAAAATGG - Intergenic
991393708 5:66179923-66179945 CTAATGTCATTCTTGAAAACAGG - Exonic
992495882 5:77292890-77292912 TTGATGTTATTTTTAACAAAAGG + Intronic
993279041 5:85901421-85901443 CTGGTGTCATTTTTAAAAATTGG - Intergenic
993737334 5:91493454-91493476 TTGATGTCAACCTTATAAACAGG + Intergenic
994032365 5:95158520-95158542 TTGTTGTTATTTTTAAAATCTGG - Intronic
994890806 5:105633004-105633026 TTGATTTCATCATTAACAACAGG + Intergenic
995970150 5:117959054-117959076 TTGTTGTTATTGTTGAAAACTGG - Intergenic
996619185 5:125479481-125479503 TTCATGTCTATGTTAAATACAGG + Intergenic
997139189 5:131360953-131360975 GTGATGTCTTTTTTAAAAGCTGG + Intronic
997182563 5:131845368-131845390 TTGATTTTTTTGTTAAAAACTGG - Intronic
997308106 5:132855614-132855636 TTGTTGTTGTTGTTAAAGACAGG + Intergenic
997477956 5:134158955-134158977 TTGATCTCATTTTAAAAAACAGG + Intronic
998047153 5:138997412-138997434 TTGGTGCCTTTGTTAAAAATGGG + Intronic
998710806 5:144823041-144823063 TTAAAATTATTGTTAAAAACTGG + Intergenic
998814353 5:145997447-145997469 TTTATGTCTTTGTGAAAAATGGG + Intronic
998883324 5:146667785-146667807 ATGAAGTCATTGGTAAAAAGAGG - Intronic
999291637 5:150429744-150429766 ATGATGTCATTCATAAAAGCAGG + Intergenic
999612905 5:153390147-153390169 TTGTTGTTGTTGTTAAAAACTGG + Intergenic
1001418687 5:171570004-171570026 TTGTTGTTGTTGTTGAAAACTGG + Intergenic
1002207626 5:177574558-177574580 TTATTGTCATTGTCAAAAATAGG - Intergenic
1004003576 6:11618947-11618969 TTGATGTCCTTGTTTTAAAGAGG + Intergenic
1004334068 6:14748034-14748056 TTGATGTCATTCTGAAAATGTGG + Intergenic
1004680244 6:17886869-17886891 TTGTTGTCGTTGTTAAAAAGAGG + Intronic
1008120097 6:47604362-47604384 TTGGTGTCATAGTTCAAAACTGG + Intronic
1009157394 6:60238242-60238264 TTGATGCCTTCGTTGAAAACGGG + Intergenic
1009252541 6:61323523-61323545 TTGATGTCTTTGTTGGAAACGGG + Intergenic
1009257227 6:61425344-61425366 TTGATGTCTTTGTTGGAAACGGG + Intergenic
1010632307 6:78212825-78212847 TTTATGTAATTGTCAAAAATAGG - Intergenic
1012617965 6:101301148-101301170 TTGATGTCAGTATCAAAAAATGG - Intergenic
1013792448 6:113853187-113853209 GTGATCTCATTGTTAAATGCTGG + Intergenic
1013855844 6:114571167-114571189 TTGATGTCTTAGTTGAAATCTGG - Intergenic
1013976485 6:116084637-116084659 TTGATGTTATTGGCCAAAACAGG + Intergenic
1014638749 6:123882336-123882358 TTGATCTCATAATTAAAAATGGG - Intronic
1017593984 6:156008895-156008917 ATGATGTCAAAGTTAACAACTGG + Intergenic
1018358783 6:163044810-163044832 ATGATGACATTTTTAACAACAGG - Intronic
1019141031 6:169943199-169943221 TGGATGTTATTATTAAAAAGTGG + Intergenic
1020407428 7:7853334-7853356 CTGATTTCATTGTAAAAAAGTGG - Intronic
1021250492 7:18319428-18319450 TTGATCTGATTTTTAAAATCTGG - Intronic
1021304396 7:19013542-19013564 GTGATCCCATTTTTAAAAACAGG - Intergenic
1021507046 7:21397384-21397406 TTGATGACATTGTTTGAACCTGG - Intergenic
1021721352 7:23507634-23507656 TTGCTGTCATTTTCAAAATCAGG - Intronic
1022237351 7:28474719-28474741 TTGATGTCAGTATTGAAAAGGGG + Intronic
1022430013 7:30309410-30309432 ATGATGTCCTAGTTAAAGACTGG + Intronic
1023358279 7:39389747-39389769 TTAATATAATTGTTAAACACAGG - Intronic
1023547044 7:41328974-41328996 TTCATGTCATTATTTAGAACTGG + Intergenic
1023846974 7:44127660-44127682 TTGTTGTTGTTGTTGAAAACTGG + Intergenic
1024807089 7:53155259-53155281 TTGATGTCATATATATAAACAGG + Intergenic
1025319598 7:58080931-58080953 TTGATGTCATATATATAAACAGG - Intergenic
1025478009 7:60951401-60951423 TTGATGTCATATATATAAACAGG - Intergenic
1025528991 7:61852753-61852775 TTGATGCCAATGGCAAAAACGGG - Intergenic
1025554114 7:62282543-62282565 TTGATGTCATATATATAAACAGG + Intergenic
1025560667 7:62370731-62370753 TTGATGTCATATATATAAACAGG - Intergenic
1026073645 7:67145447-67145469 CTGGTTTCATTTTTAAAAACTGG + Intronic
1026408553 7:70094467-70094489 TTGATTTGAAAGTTAAAAACCGG + Intronic
1026703241 7:72666729-72666751 CTGGTTTCATTTTTAAAAACTGG - Intronic
1027351432 7:77315662-77315684 ATAATGTCACTGTTAATAACTGG + Intronic
1027581544 7:80003115-80003137 TTGTTTTCATTATTAAATACTGG - Intergenic
1027759553 7:82260755-82260777 TTGATGTCATTGTTAAAAACAGG - Intronic
1027922809 7:84418003-84418025 TTGATGTGATTGTTAATATTAGG + Intronic
1027967909 7:85037866-85037888 TTGATCTCATTTTTGAAAATGGG - Intronic
1028579400 7:92390361-92390383 TTTATGTCTTTGTTTTAAACTGG + Intronic
1028947699 7:96599626-96599648 TTCATGTCATTTTTAAAAGAGGG - Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030339495 7:108360916-108360938 TTGATGTCATATATAAAAAATGG - Intronic
1031144213 7:117979676-117979698 ATGATGGCATTTTTAAAAAATGG - Intergenic
1031199225 7:118658018-118658040 TTGAAGTCATTGCTAACAAAAGG + Intergenic
1031250497 7:119373930-119373952 TTGATATCATTGTTAATCATGGG - Intergenic
1031252896 7:119411627-119411649 CCATTGTCATTGTTAAAAACTGG - Intergenic
1032600557 7:133289424-133289446 TAGATTTCATTGTTTAAAATGGG - Intronic
1035868953 8:3115810-3115832 TCGATGTCTTTATTAAAAATTGG - Intronic
1036098611 8:5752703-5752725 TTGTTGTTGTTGTTAAAAATGGG + Intergenic
1036184073 8:6609122-6609144 TTGATTTCATCCTTAAAAAATGG - Intronic
1039870976 8:41544990-41545012 TTGATGTCATTTTTAAATAAAGG + Exonic
1040353371 8:46590848-46590870 TTGATTTCATTATAAAGAACTGG - Intergenic
1040364138 8:46696906-46696928 TTGATTTCATTATAAAGAACTGG + Intergenic
1040799151 8:51322007-51322029 TTGGTGTCCTTGTAAAAAAGAGG + Intronic
1041273411 8:56131991-56132013 TTGTTGTTGTTGTTAAAGACAGG - Intergenic
1042748093 8:72129375-72129397 TTAATATCATTGTTAATCACAGG - Intergenic
1043336939 8:79187596-79187618 TTGAAGTCATTGTGAAATATAGG + Intergenic
1044638067 8:94347418-94347440 TTGATATTTTTGTTGAAAACTGG - Intergenic
1044752119 8:95426411-95426433 TTGAATTCAATCTTAAAAACTGG + Intergenic
1047198316 8:122741731-122741753 GTGAAGTCATTTTTAAAAGCAGG + Intergenic
1047454863 8:124999230-124999252 TTTATATGATTTTTAAAAACTGG + Exonic
1050084713 9:1952351-1952373 ATGATGCCTTTGTTAAAAAATGG - Intergenic
1050179622 9:2906374-2906396 TTGATTTCCTTATTAAAAAGAGG - Intergenic
1050536263 9:6633529-6633551 TTGATGTCATTGATTAACAGAGG - Intronic
1050639757 9:7654710-7654732 TTGATCTCATCGTTAGTAACGGG - Intergenic
1051283381 9:15467035-15467057 TTGATGGCTTTGTCAAAAAGGGG + Intronic
1052242150 9:26286765-26286787 TTTATGTTGTTTTTAAAAACTGG + Intergenic
1052578092 9:30316683-30316705 TTGTTGTTATTTTAAAAAACTGG + Intergenic
1054824692 9:69561457-69561479 TTGATGTTATTGTTTAACTCAGG - Intronic
1055505482 9:76944017-76944039 TTGTTGTCATTTTTAGAGACTGG - Intergenic
1055807572 9:80114056-80114078 TTATTGTCATTGTTGAAAATTGG + Intergenic
1055921976 9:81470561-81470583 TTGATTTAACTGTTAAAAACTGG - Intergenic
1055922937 9:81480828-81480850 TTGATATCTTTGATAAATACAGG + Intergenic
1055937895 9:81620478-81620500 TTGATGTCATTGGAAAATTCAGG + Exonic
1056582206 9:87897563-87897585 TTGTTGTAGTTGTTGAAAACTGG - Intergenic
1057976683 9:99612231-99612253 TTGTTGCCTTTTTTAAAAACTGG - Intergenic
1058093403 9:100830825-100830847 TTGCTGACATTGTTGAAAACTGG + Intergenic
1059832905 9:118118377-118118399 TTTATGTTATTGTTTAAAGCTGG - Intergenic
1060716946 9:125940723-125940745 TTGATTTCATTTATAAAAAATGG + Intronic
1061860557 9:133465913-133465935 TTGATTTCATTGTTAGAAATGGG - Intronic
1185813132 X:3129008-3129030 TTGTTGTTATTGTTTAAGACAGG - Intergenic
1187022285 X:15396514-15396536 TTTATGTCATTCTTATAAAGAGG - Intronic
1187386874 X:18857151-18857173 TTGTTGTCATTTTTAAACAAGGG + Intergenic
1187833226 X:23404191-23404213 TTGATATCAGTATTGAAAACAGG - Exonic
1188072432 X:25733339-25733361 TTGATGTCATTACAAAAAAGTGG - Intergenic
1188202609 X:27309596-27309618 TATGTCTCATTGTTAAAAACTGG - Intergenic
1189654690 X:43231608-43231630 TTGTTATCATTGTTAGAAACTGG + Intergenic
1190487152 X:50939201-50939223 TTGATGAGATTTTTAAAAATGGG + Intergenic
1190944503 X:55078068-55078090 GTTATGTATTTGTTAAAAACAGG - Intronic
1190945746 X:55092001-55092023 GTTATGTATTTGTTAAAAACAGG - Intronic
1190964298 X:55283393-55283415 GTTATGTATTTGTTAAAAACAGG - Intronic
1191729805 X:64321130-64321152 TTGTTGTTGTTGTTGAAAACTGG - Intronic
1193164800 X:78266490-78266512 TTCCTGTCATTTTTAAGAACAGG + Intergenic
1193727071 X:85054348-85054370 TTTATGTCTTTGTGAAAAATGGG + Exonic
1195509207 X:105694824-105694846 TTGATGTGATTACTAAAAAGTGG - Intronic
1196020349 X:110984690-110984712 TTGTTGTCATTTTTAAAATGAGG + Intronic
1196249374 X:113441317-113441339 TTGTTGTGGTTGTTGAAAACTGG - Intergenic
1197426970 X:126308667-126308689 TTGATATCATTTTCAAAACCAGG - Intergenic
1198267735 X:135025058-135025080 TTTATATCAGTGTTAAAAATAGG + Intergenic
1198647014 X:138819600-138819622 TTAATGTCATATTTAAAAAGCGG - Intronic
1199361977 X:146931475-146931497 TTGATGTCTTCCTGAAAAACTGG - Intergenic
1199840404 X:151641183-151641205 TTGATGTGTTTGTGGAAAACTGG + Intronic
1201268472 Y:12231534-12231556 TTGTTGTTATTGTTTAAGACAGG + Intergenic