ID: 1027760959

View in Genome Browser
Species Human (GRCh38)
Location 7:82278202-82278224
Sequence CAATTTATTCAAAAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 398}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027760956_1027760959 28 Left 1027760956 7:82278151-82278173 CCCATATAAAAATAGGAGATTGT 0: 1
1: 1
2: 0
3: 20
4: 349
Right 1027760959 7:82278202-82278224 CAATTTATTCAAAAGATGGAAGG 0: 1
1: 0
2: 1
3: 37
4: 398
1027760957_1027760959 27 Left 1027760957 7:82278152-82278174 CCATATAAAAATAGGAGATTGTC 0: 1
1: 0
2: 6
3: 33
4: 304
Right 1027760959 7:82278202-82278224 CAATTTATTCAAAAGATGGAAGG 0: 1
1: 0
2: 1
3: 37
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027760959 Original CRISPR CAATTTATTCAAAAGATGGA AGG Intronic
900273799 1:1809937-1809959 CATTTTACTCAAAGGAGGGAGGG + Intronic
901092139 1:6648983-6649005 AATTTTTTTTAAAAGATGGAAGG - Intronic
905008754 1:34732386-34732408 CAATTTATTCCAAAGATGTGTGG + Intronic
907104512 1:51869917-51869939 AAATTTTTTTAAGAGATGGAGGG + Intronic
907149682 1:52272132-52272154 CTATTTCTTCAAAATATGGCTGG - Intronic
907629164 1:56062585-56062607 AAATTGATCCAAAACATGGAGGG + Intergenic
908897168 1:68913360-68913382 TAATTTATTCTAAAGATGATAGG - Intergenic
908993971 1:70129413-70129435 CAATTTGTTCTAAAGAGGAAAGG + Intronic
908998838 1:70193437-70193459 CAATTTCTTTAATAGATGCAAGG - Intronic
909089632 1:71209108-71209130 CATTTTATTCAAAGAATGAAGGG - Intergenic
909217466 1:72908697-72908719 AAATATATTTAAAAAATGGATGG + Intergenic
909684477 1:78331780-78331802 GTATTTATTCCAAAGGTGGATGG + Intronic
910817691 1:91310266-91310288 AATTTTCTTCAAAATATGGATGG + Intronic
911286694 1:96003054-96003076 CAATTTTTTAGAAAGGTGGAAGG - Intergenic
911766733 1:101685747-101685769 CAATTTGTTAAAAAGATTCAAGG + Intergenic
912364810 1:109124636-109124658 CAATTTCTCCAAAAGATAAATGG - Intronic
912706265 1:111916874-111916896 CAATTTATTTAATAGATATAGGG - Intronic
913554450 1:119951022-119951044 CAATTAGTTGAAAAGATGAATGG + Intronic
914426199 1:147579244-147579266 TTTTTTATCCAAAAGATGGAAGG + Intronic
915966157 1:160310488-160310510 CAAATTATTCAACAGAAGGTAGG + Intronic
916803499 1:168236286-168236308 CATTTGAATGAAAAGATGGATGG + Intronic
917166218 1:172116007-172116029 CCATCTATTCAACGGATGGATGG + Intronic
918603300 1:186390100-186390122 CAATTTTTTAAAAAGTTGGCTGG - Intronic
918763838 1:188452326-188452348 TAATTTCTTGAAAACATGGAGGG - Intergenic
919411108 1:197244253-197244275 CAGTTTCTTCAAAGTATGGATGG + Intergenic
919595267 1:199553678-199553700 CAAGTTATACAAGAGATGGATGG + Intergenic
920304509 1:205009974-205009996 CAATTTATAGAACAGATGGGTGG - Intronic
920627255 1:207614187-207614209 CAATTTATTCTAAAGAACCATGG - Intronic
920637201 1:207715094-207715116 CAATTTATTCTAAAGAACCATGG - Intronic
921666105 1:217873568-217873590 GAATATATTCTAAAGATAGAAGG - Intergenic
921724964 1:218513645-218513667 CAAATTATGCAAAAGATCTATGG - Intergenic
921785279 1:219222077-219222099 CAAAATATTCAATAGATGTATGG + Intergenic
922431923 1:225563355-225563377 CAATTTATTCACAAGTTTAACGG + Intronic
924440953 1:244084771-244084793 CAATTTATTGAATGAATGGATGG + Intergenic
1063172503 10:3522032-3522054 CAATTTATTTAGAAGATTAATGG - Intergenic
1064045243 10:12008159-12008181 CAATTTTTTAAAAAGATACAAGG + Intronic
1065662007 10:28014288-28014310 CTATTTTTTAAAAAAATGGAAGG - Intergenic
1065669267 10:28096548-28096570 CTATTTGTTAAAAAGATGTAAGG + Intronic
1066039710 10:31535775-31535797 GATTTTATTCAAAAGAAGGTAGG + Intergenic
1068082025 10:52330900-52330922 CAAATTTTTTAAAAGATTGATGG + Intergenic
1068436397 10:56997012-56997034 GAATTTATTCCGAAGATGCAAGG + Intergenic
1069880453 10:71589423-71589445 CAATTTTTTTAAAAGAAGGAAGG + Intronic
1070346713 10:75550743-75550765 CAAATAATTCAAAAGAAGGCAGG - Intronic
1070511515 10:77165501-77165523 CAATTCAGTCAAAAGACCGAAGG + Intronic
1071021291 10:81060155-81060177 AAAGTTATTCAAAAGATGCTAGG + Intergenic
1071175556 10:82922866-82922888 CAATTTGGTCAATGGATGGATGG - Intronic
1071832716 10:89387970-89387992 CAAATTATCCAAAATATGTAGGG + Intronic
1072840136 10:98763949-98763971 CAAATAATTTAAAAGATGTATGG + Intronic
1074549747 10:114431416-114431438 GAATTTTTTCAAATGTTGGAAGG - Intronic
1074643683 10:115418789-115418811 CAATATATTCAGAATGTGGAAGG + Intronic
1075504042 10:123006535-123006557 CAGTTTATAAAAAAGATAGAAGG - Intronic
1075735554 10:124662506-124662528 AAATTTATTGAATACATGGATGG - Intronic
1075817517 10:125276651-125276673 CAATGTTTTCAAAATATGGAAGG + Intergenic
1075831217 10:125413279-125413301 CAATTTACTCAAAACATGCCAGG - Intergenic
1077806096 11:5592581-5592603 CAAATTTTTAAAAAGAAGGAAGG + Intronic
1079442478 11:20529062-20529084 CCAATTATAAAAAAGATGGATGG - Intergenic
1079585372 11:22120324-22120346 CAATTTCTTCATAAGATAAAGGG - Intergenic
1079755921 11:24261920-24261942 CTATTTATTCACAAGATGTCAGG - Intergenic
1081825353 11:46045611-46045633 CAATGTATTCAAAAAAAGAATGG + Intronic
1082926499 11:58553031-58553053 CAGCTTATTCAAAAGATAAATGG + Intronic
1083927111 11:65814609-65814631 CTATTTATTAAACAGATGGATGG + Intergenic
1085834502 11:79937897-79937919 CTATATATGCAAAAGATGGATGG - Intergenic
1085951126 11:81332508-81332530 CATTTTATTTAACAGATGAATGG - Intergenic
1087766125 11:102156223-102156245 CAACCTCTTCAAAAGATGGTTGG - Intronic
1088178301 11:107079338-107079360 TAATTTATTCAATAGATATAGGG + Intergenic
1088641813 11:111879935-111879957 CAATATATGCAAAAGCTTGATGG + Intronic
1089011425 11:115135315-115135337 GAATTTATTTAAAAGGTGGCCGG + Intergenic
1089111003 11:116056061-116056083 CTATTTATTATAAAGATGTAGGG + Intergenic
1089241015 11:117079411-117079433 TCATTTATTCAATAAATGGAGGG + Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089421376 11:118333356-118333378 CAATTTATTTAATAGATAAAGGG - Intergenic
1089879745 11:121762458-121762480 AAATTAATTAAAAAGAAGGAGGG + Intergenic
1092660879 12:10736842-10736864 CAATTTTTTAAACAGAGGGAGGG + Intergenic
1092876119 12:12849412-12849434 CAATTTATTGAAAAGTGGGCAGG - Intergenic
1093068329 12:14682392-14682414 CACTTTCTTCAAAAGGTGGCAGG - Intronic
1093382385 12:18508963-18508985 CTATTTCTTAAAAACATGGAAGG + Intronic
1094724296 12:33097233-33097255 CCATTCATTCACAAGATGGCTGG - Intergenic
1095173971 12:39068992-39069014 CAATTTATTCTAATGAGGAAAGG + Intergenic
1095496141 12:42786314-42786336 CATTTAAGTCAAAAGAGGGAGGG + Intergenic
1095901429 12:47332511-47332533 GAGTTTATTCCAAAGATGCAAGG - Intergenic
1096006648 12:48178754-48178776 TAATTTATGGAAAAGATGGAAGG + Intronic
1096030616 12:48410810-48410832 GAACTTACTCAAAACATGGAGGG - Intergenic
1096930711 12:55205833-55205855 CCAAATATTCAAAAAATGGAAGG + Intergenic
1097632796 12:62084419-62084441 TCATTTATTCACAAGAAGGAGGG + Intronic
1097690137 12:62727372-62727394 TAACTTTTTCAAAAGATTGAAGG - Intronic
1098406883 12:70136047-70136069 GGTTTTATTCAAAAGATGCAAGG + Intergenic
1099063568 12:77944474-77944496 AAATTTCTTAAAAAGGTGGAGGG + Intronic
1099076933 12:78121480-78121502 CAGTTTATTCAAAATCTAGATGG - Intronic
1099254913 12:80303674-80303696 CAACTTCTTCAAAAGGTGGCTGG + Intronic
1100086116 12:90913129-90913151 CAATTTCTTCACAAGGTGGCAGG + Intronic
1100116220 12:91307979-91308001 CTGTTTCTTCAAATGATGGAAGG + Intergenic
1100227548 12:92574264-92574286 GAATTTATTCAAAGGATGTTGGG + Intergenic
1101684972 12:107010050-107010072 CAATTTATTTAAGAGATATAGGG + Intronic
1102148464 12:110672041-110672063 ATATTTTTTCAAAAGATGAAAGG - Intronic
1102771580 12:115481808-115481830 CAACTTACTAAAAAGATGGTAGG + Intergenic
1103607605 12:122098741-122098763 CACTTTATTCAAAACAATGATGG - Intronic
1103854014 12:123952282-123952304 CAATTACTTCCAAAGAGGGAAGG + Intronic
1105249652 13:18686442-18686464 CAATTTTTTCACAAAATGTATGG + Intergenic
1106197758 13:27508913-27508935 CAATTGATTCATAATATGGGCGG + Intergenic
1106535284 13:30635823-30635845 TAATTAATTCAAAAGATATATGG - Intronic
1106703272 13:32252452-32252474 CCATTCATTCAAAAGCTTGATGG - Intronic
1107326378 13:39247722-39247744 CAAATTCTTCAATAGATGAATGG + Intergenic
1107741730 13:43457462-43457484 CAATTTATCAATAAGAAGGAAGG + Intronic
1107903182 13:45038600-45038622 CTCTTGATTCAAAAGATAGAAGG + Intergenic
1108833400 13:54507795-54507817 CAATTTTTTAAAAAAATGAAAGG - Intergenic
1109087223 13:57990159-57990181 TAATTTATTTAAAAAAAGGATGG + Intergenic
1109185063 13:59258668-59258690 CAATTTTTTCAAAAGGTGTAGGG - Intergenic
1109205679 13:59480258-59480280 CAATTTATTCATCAGATGGGAGG + Intergenic
1109362458 13:61313393-61313415 AAAATTATTCAAAAAATTGAAGG - Intergenic
1111012755 13:82332412-82332434 CAATTTATTTAAAATATTGAAGG - Intergenic
1111878794 13:93929786-93929808 CAATGTATTTAAAAGAAAGAAGG + Intronic
1112062002 13:95750202-95750224 CCATTTATTGAAGAGATTGATGG - Intronic
1112305844 13:98272887-98272909 CAATTTTGTCAAAAGCTAGAAGG + Intronic
1113184901 13:107676669-107676691 CAATTTACAGAAAAGATGAAAGG + Intronic
1113610672 13:111642660-111642682 CAATTGATTCAAAGGAAGGTAGG - Intronic
1113684101 13:112268346-112268368 CACTTTATTCAAAATATGGAAGG + Intergenic
1114051811 14:18925491-18925513 CAATTTATTCAGCAAATGCAGGG + Intergenic
1115091629 14:29583611-29583633 CAAGGTATTAAAAAGATGAAAGG - Intronic
1115340730 14:32290945-32290967 CCATTGCTTCAGAAGATGGAAGG + Intergenic
1117457254 14:55910963-55910985 CAGTTTCTTCAAGAGATGGAAGG - Intergenic
1117549573 14:56820618-56820640 CAAATTATTCAGAAGGTTGAGGG + Intergenic
1118754040 14:68825157-68825179 CAATTTTTTCAAAAGAAAAAAGG + Intergenic
1120394667 14:83954040-83954062 CTATTTCCTCACAAGATGGAAGG - Intergenic
1120571755 14:86127005-86127027 CAATATATTCAATAGATTAAAGG - Intergenic
1120610185 14:86631052-86631074 AAATTTATTCCAAAAATGCAAGG - Intergenic
1121386469 14:93531342-93531364 CAATTTATTTAAAAGATCAAAGG - Intronic
1123497229 15:20840049-20840071 CAACTTCTTCAAAAGGTGGCAGG + Intronic
1123554464 15:21413687-21413709 CAACTTCTTCAAAAGGTGGCAGG + Intronic
1123590708 15:21851002-21851024 CAACTTCTTCAAAAGGTGGCAGG + Intergenic
1123886445 15:24732295-24732317 CAATTTATACTAACCATGGATGG + Intergenic
1124071779 15:26401747-26401769 CAGCTTATTCAAAAGATGCCTGG + Intergenic
1125263562 15:37854046-37854068 CTAATTTTTCAAAAGAAGGAAGG - Intergenic
1131936825 15:97515509-97515531 CTTTTTCTTCAAAAGAAGGAGGG - Intergenic
1132007877 15:98246665-98246687 AAATTCATTCAAAAGATTGATGG - Intergenic
1202962811 15_KI270727v1_random:140881-140903 CAACTTCTTCAAAAGGTGGCAGG + Intergenic
1133195301 16:4165614-4165636 TAATTTATTTAAAAGATTCAGGG - Intergenic
1133389467 16:5397606-5397628 CAATTTCTTCAATAGATGAAAGG + Intergenic
1134828471 16:17304056-17304078 CAATTTATGCTAACGTTGGAAGG + Intronic
1136657538 16:31719355-31719377 CAATTTAATCAAAACATGTAGGG - Intronic
1136670974 16:31857094-31857116 CAAAGTATTCAAAAAATAGAAGG + Intergenic
1136673833 16:31881142-31881164 CAATTTAACCAAAACATGTAGGG - Intronic
1137563066 16:49515418-49515440 CAATTTATTTAAACTTTGGAGGG + Intronic
1137580247 16:49629364-49629386 AAATTAATTCAAAAGATGGTAGG - Intronic
1137781244 16:51099369-51099391 CACTTTCTTCACAAGATGGCAGG - Intergenic
1139739578 16:69023814-69023836 TAAATTATTGAAAAGATGAATGG + Intronic
1140635722 16:76910900-76910922 AAATTTATACAAAACATGGATGG - Intergenic
1140886308 16:79246844-79246866 AAAATTATTGAAAAGATGGATGG - Intergenic
1141074952 16:80996777-80996799 TAATGTATTCCAAATATGGATGG + Intronic
1141368535 16:83466188-83466210 GAAGTCATTCAAAAGTTGGAAGG + Intronic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1143079850 17:4373347-4373369 TAATTTATTGAAAAGAGGGCTGG + Intergenic
1143209398 17:5172880-5172902 CAATTTCTGCCAAAGATTGATGG + Exonic
1144618879 17:16802334-16802356 CAATTTCTGCCAAAGATTGATGG + Intronic
1144893827 17:18513361-18513383 CAATTTCTGCCAAAGATTGATGG - Intergenic
1145138401 17:20430913-20430935 CAATTTCTGCCAAAGATTGATGG + Intergenic
1148454579 17:47804218-47804240 CACTTTATTCAGAAGATGCAAGG + Intergenic
1148566530 17:48636187-48636209 CAAATTATTCAGAAAATTGATGG + Intergenic
1148825588 17:50391501-50391523 CAATCTGTTCCAAAGCTGGAGGG + Intronic
1149180364 17:53929261-53929283 GGATTTATTCCAAAGATGTAAGG - Intergenic
1150114478 17:62533929-62533951 GAACTTATTAAAAAGATGGTAGG - Intronic
1151110963 17:71677141-71677163 AAAGTTGTACAAAAGATGGATGG + Intergenic
1152302241 17:79501930-79501952 CCATTTATTAAAATGGTGGATGG + Intronic
1153572766 18:6489577-6489599 CAATTAATCAAACAGATGGATGG + Intergenic
1153603284 18:6804109-6804131 CAATTTATTTAATAGATAAAGGG + Intronic
1154145339 18:11862031-11862053 CAATGTAAACAAAACATGGAAGG - Intronic
1154455251 18:14516455-14516477 CAACTTCTTCAAAAGGTGGCAGG + Intronic
1154518921 18:15205383-15205405 TAATATATTCAAAAGATGCAAGG - Intergenic
1155879283 18:31123694-31123716 CAATTTGTACAAAAGATAGTTGG + Intergenic
1156109749 18:33711630-33711652 TAATTTATTCAAATGATAAAGGG - Intronic
1156395903 18:36699671-36699693 AAATGTGTTCCAAAGATGGATGG - Intronic
1157852766 18:51072848-51072870 CAATTTAGTCAAATTATGAAAGG + Intronic
1158265611 18:55657856-55657878 CAGTTTATGCAAAAGCAGGAGGG + Intronic
1158344298 18:56499994-56500016 CAATGCATTTAAAAGATGGGAGG - Intergenic
1159332609 18:67017735-67017757 CAATTTATAGAAAAGGTTGATGG + Intergenic
1160368843 18:78353645-78353667 CAATACATTCAAAAGAAGGCAGG - Intergenic
1160502601 18:79409715-79409737 CAATTTGTTTAATGGATGGATGG - Intronic
1163272909 19:16264921-16264943 CAATTTTTTAAAAAGTTGGCCGG - Intergenic
1163871172 19:19822363-19822385 GAATATATTCAAAAGGTGAACGG + Intergenic
1163916075 19:20241866-20241888 GAATGTATTCAAAAGATGAACGG - Intergenic
1164863798 19:31586859-31586881 CGATTGATTCAAAAGATGGTAGG - Intergenic
1164960122 19:32420744-32420766 CAATTTATTAAACACATGGCAGG - Intronic
1165605580 19:37101191-37101213 CAATTTATTCAAGAGTTTGCAGG + Intronic
1167035125 19:46990681-46990703 CAATTTATTCACAAGCCTGATGG + Intronic
926745198 2:16151173-16151195 CAATGTCTTCTGAAGATGGATGG + Intergenic
927539099 2:23891425-23891447 CTATTTTTTGAAAAGAAGGAAGG + Intronic
929434166 2:41914629-41914651 CAATTTCTTCACAAGGTGGCAGG - Intergenic
930249301 2:49017698-49017720 ATATTTATTGAAATGATGGATGG - Intronic
930804161 2:55473274-55473296 CATTTTTTTTAAGAGATGGAGGG - Intergenic
932182234 2:69657827-69657849 GCATTTATTCACAAGATGAATGG + Intronic
932482057 2:72048954-72048976 AAAATTATTCAAAAGAATGAAGG + Intergenic
933065289 2:77785209-77785231 CAATTTATTTAACAGATATAGGG + Intergenic
934036164 2:88090047-88090069 CAATTTATTCAACCTATAGATGG + Intronic
935076459 2:99749574-99749596 CATTTTATTCTAAGGATGGCAGG + Intronic
935180378 2:100684600-100684622 CAATTAATTCAAAAGAAGGGAGG + Intergenic
935325076 2:101928430-101928452 CACTTTCTTCACAAGATGGCAGG - Intergenic
935706056 2:105858567-105858589 CATTTTATTCCAAAGCAGGAAGG - Intronic
936231625 2:110706160-110706182 CAATTTTTTAAAAAGAGTGAGGG - Intergenic
937503306 2:122507539-122507561 CATTTTATTAAAAATATGAAAGG + Intergenic
937719004 2:125070355-125070377 CATTTTATTCATAATCTGGAGGG + Intergenic
937872357 2:126795242-126795264 CATTATTTTAAAAAGATGGAAGG + Intergenic
938787958 2:134650075-134650097 CAATTGAGTGAAAAAATGGAAGG + Intronic
939006748 2:136797351-136797373 CCATTCATTCAAAACATGGAAGG - Intronic
939115112 2:138051790-138051812 CAATTTGTTCAAAATTTGGGGGG - Intergenic
939168266 2:138663090-138663112 CAATTTCTTTTAAATATGGATGG + Intergenic
939373989 2:141340169-141340191 CAAACTATTCAAAAGTTGAAGGG - Intronic
939473874 2:142660633-142660655 TAATTTATTCAACAGAGAGATGG + Intergenic
939487198 2:142829391-142829413 TAATTTTTGCACAAGATGGAAGG + Intergenic
939683147 2:145163647-145163669 TAATTTATGCCAAAGATGTATGG + Intergenic
939757159 2:146128922-146128944 CACTTTTTTCACAAGATGGCAGG + Intergenic
940353478 2:152715361-152715383 CAATTTATGCTAGAGATGGAAGG + Intronic
940409362 2:153342700-153342722 CAACTAAATCAGAAGATGGAGGG - Intergenic
941498063 2:166231792-166231814 AAACTTATTAAAAAGACGGACGG - Intronic
941541259 2:166788028-166788050 CATTCTACTCAAAAAATGGAAGG - Intergenic
941853808 2:170210282-170210304 CAGTTTAAACAAATGATGGAAGG - Intronic
941972774 2:171370084-171370106 CAATTTATCCAAAAGCAGGCAGG + Intronic
943256621 2:185601954-185601976 CACTTTCTTCACAAGATGGCTGG + Intergenic
943273024 2:185831495-185831517 CAATTCAGTCAAAGGATAGAGGG + Intronic
943914826 2:193617218-193617240 CAATTTATTCTGGAGAAGGAAGG + Intergenic
944396753 2:199276705-199276727 CAATTTATGAAAAAGCTGGCAGG + Intronic
944967347 2:204950200-204950222 CAATATATTCAAAATGGGGAGGG - Intronic
945625572 2:212201205-212201227 TAATATATTCATAAGAAGGATGG - Intronic
947051062 2:226043463-226043485 CAATGTATTCAAATAAAGGACGG + Intergenic
947905562 2:233759211-233759233 CCATTTATGCAAATGAAGGATGG + Intronic
948006434 2:234611866-234611888 GAGTTTATTCAAAAGATTGTGGG - Intergenic
948042509 2:234914472-234914494 CAATCCATTGAAAAGATGCAAGG + Intergenic
1169669942 20:8086835-8086857 CAATTTCTTTAAAAGATATAGGG + Intergenic
1169767552 20:9164027-9164049 TAATTAATACAAAAGATGAAGGG + Intronic
1170198487 20:13716119-13716141 AAATTTGTTCAAACAATGGAGGG - Intronic
1170237359 20:14121565-14121587 CAAATACTTCAAAAGATAGAAGG - Intronic
1170710862 20:18789508-18789530 CAACTGATTCTAAAGATGGAAGG - Intergenic
1174728520 20:52890500-52890522 CAATTTATTATAAAGATATAGGG - Intergenic
1174753966 20:53140237-53140259 CATTATATTTAAAAGATAGAGGG + Intronic
1174879243 20:54259872-54259894 CAATTAATCCAAAAGAAGGCAGG - Intergenic
1175621112 20:60448392-60448414 CATTTTATTCACAAGAGGAAAGG - Intergenic
1176818918 21:13636858-13636880 CAACTTCTTCAAAAGGTGGCAGG - Intronic
1177899656 21:26898798-26898820 CACTTTCTTCACAAGATGGCTGG + Intergenic
1178199102 21:30382216-30382238 CATGTTATTCAAAAGATGTTTGG - Intronic
1179773677 21:43644681-43644703 CATGTTATTTAAAGGATGGAAGG + Intronic
1180470284 22:15647870-15647892 CAATTTATTCAGCAAATGCAGGG + Intergenic
1181083455 22:20428661-20428683 CACTTATTTCTAAAGATGGAGGG - Intronic
1181773490 22:25143522-25143544 CAATTTATAGAAAGGAAGGAAGG - Intronic
949900576 3:8811764-8811786 CATTTGCTTGAAAAGATGGATGG + Intronic
951009829 3:17663992-17664014 CCATTTATTCGAAAGATGTTGGG - Intronic
951130293 3:19034490-19034512 GGATTTATTCCAAAGATGCAAGG + Intergenic
951203750 3:19903681-19903703 CGAATTATTCAAAATAAGGATGG - Intronic
951814334 3:26736765-26736787 CAATTTATTCTCAAGAAGGCAGG + Intergenic
951853202 3:27166504-27166526 CAGATTATGAAAAAGATGGAGGG + Intronic
952717891 3:36499517-36499539 CAATCAATTCAAAAGAAAGAAGG + Intronic
954174474 3:48833210-48833232 TAATTTTTTGAAAAGATGGGGGG + Intronic
954940157 3:54364459-54364481 CAAATTGTTTAAATGATGGACGG + Intronic
955031063 3:55219078-55219100 GGATTTATTCCAGAGATGGAAGG - Intergenic
955079515 3:55645552-55645574 CACATTTTTCAAAAGATGCAAGG - Intronic
955467796 3:59254543-59254565 CATTCTAATCAAATGATGGATGG - Intergenic
956656439 3:71557680-71557702 TACTTTATTCAAACGATGAAAGG + Intronic
956903422 3:73740839-73740861 CCATTTATCCAATAGATGGGAGG + Intergenic
957853331 3:85840287-85840309 CATTTTTTTCTAAAAATGGAAGG - Intronic
958690013 3:97452571-97452593 AAATCTATTCTAAAGAAGGAAGG - Intronic
960634721 3:119772754-119772776 ACATTTATTCCAAAGATGCAGGG + Intergenic
963031596 3:140983645-140983667 CAATTTAATCAAAGTAAGGAGGG + Intergenic
963596096 3:147326967-147326989 CAATTTATTTAAAATATGAATGG + Intergenic
964695290 3:159500955-159500977 CAATTTATTAAAAAGAATTAAGG - Intronic
965148195 3:164933768-164933790 CAGTTTATGGAAAAGATGAAAGG + Intergenic
965633140 3:170754063-170754085 CAGTTTATTCAGAAGAGGGTAGG - Intronic
968025430 3:195438451-195438473 AAGTTTATTATAAAGATGGAAGG + Intronic
968435411 4:584664-584686 CAATTTATTTAACAGATATAGGG + Intergenic
969298474 4:6283205-6283227 CAAATAATTAAAAAGATGTAGGG + Intronic
970764708 4:19533493-19533515 AATTATATTCAAAAGATGCAAGG - Intergenic
971862958 4:32131978-32132000 CAATTTAATGAAGAGATGAATGG + Intergenic
972128148 4:35796099-35796121 CAGTTTGTTCAAAAAATTGAGGG + Intergenic
972582624 4:40408037-40408059 CAGATTATTCAGAATATGGAAGG - Intergenic
972752139 4:42000792-42000814 CAAGTTTTTCCAAGGATGGAGGG - Intronic
973904480 4:55514347-55514369 TAATTTTTTCAAAAGAGGTAAGG - Intronic
974128733 4:57728151-57728173 CAAATGATTCAAAAGGTAGAAGG - Intergenic
974206898 4:58715816-58715838 TTGTTTATTCAAAAAATGGAGGG - Intergenic
974504292 4:62748164-62748186 CAATTCCTTCAAAAAATTGAAGG + Intergenic
974830862 4:67187737-67187759 AAATTAATTGAAAAGATGGTGGG + Intergenic
974903974 4:68034055-68034077 CACCTTATTCAAAATATTGATGG + Intergenic
975428999 4:74266434-74266456 CAAATAATTAAATAGATGGAAGG - Intronic
975480965 4:74879830-74879852 AAATTTATTCAAATGTTGGCTGG - Intergenic
975981474 4:80165201-80165223 CAATTTACTCAAATAATGCAAGG - Intergenic
976027065 4:80701104-80701126 CTTTTTATTCAAAGTATGGAAGG - Intronic
977015852 4:91692769-91692791 CACTTTCTTCACAAGATGGCAGG + Intergenic
977762439 4:100755617-100755639 CCAGTCATTCACAAGATGGATGG + Intronic
977819131 4:101451950-101451972 CTATTTTTTAAAAAGATGCAAGG - Intronic
977909480 4:102515510-102515532 TGATTTATTCAAAGGATGGCAGG - Intronic
978344118 4:107748472-107748494 AGTTTTATTCTAAAGATGGAGGG + Intergenic
978604920 4:110468842-110468864 CAAAGCATTCAGAAGATGGAAGG + Intronic
982313880 4:154011605-154011627 CCATTGAATCAAAAGATGGCAGG + Intergenic
982364614 4:154561952-154561974 TATTTTATTAAAAAGATGGCAGG - Intergenic
982787763 4:159556233-159556255 GAATTTACTCAAAAGGAGGAAGG - Intergenic
982945929 4:161622213-161622235 CAATTTATTTAAGAGATAAAAGG - Intronic
983330141 4:166316108-166316130 TAATTTTTTCCACAGATGGAGGG - Intergenic
983349395 4:166568789-166568811 AAATTTCTTTAAAAGGTGGAAGG + Intergenic
983782652 4:171691238-171691260 CTATTGATTCAAAAGTTGCAAGG - Intergenic
985348816 4:189035969-189035991 CAATTTATTGAAAAGCTTCACGG - Intergenic
985954274 5:3251478-3251500 CAATTTCTTTAAAAGATACAGGG + Intergenic
986494122 5:8324775-8324797 CAATTTATTTAACAGATATAGGG - Intergenic
986618626 5:9646383-9646405 TACTTTGTTCAAAAGATGCATGG + Intronic
987011284 5:13768310-13768332 CACTTTCTTCACAAGATGGCGGG - Intronic
987390661 5:17372196-17372218 TAATATATTTAAAAAATGGATGG + Intergenic
987750570 5:22033752-22033774 CACTTTATTAAAAATATGTAAGG - Intronic
987983076 5:25113692-25113714 CAATCTATTCAAATTATAGATGG - Intergenic
989266285 5:39478007-39478029 TAATTTATTCCAAAGTTGCAGGG - Intergenic
989799455 5:45518762-45518784 TAATTTGTTGAAAAGAGGGAAGG + Intronic
990087517 5:51996967-51996989 CAATTGATTGAAAAGGTGGAGGG + Intergenic
990182478 5:53176997-53177019 CAATTTATTTAAAAGGTATAGGG - Intergenic
990471951 5:56123596-56123618 CAATAAATTCAGCAGATGGAGGG + Intronic
990492156 5:56313005-56313027 CATTTTGTGTAAAAGATGGAAGG + Intergenic
990620403 5:57553014-57553036 CAATATATAAAAAAGAAGGAAGG - Intergenic
992228011 5:74637636-74637658 CTATTTAATCAAAAGACGGATGG - Exonic
993088165 5:83390457-83390479 CCAGTTATTAAAAAGATTGATGG + Intergenic
993443208 5:87980589-87980611 CAATTTCTGCAAAGGAAGGATGG + Intergenic
993739008 5:91513731-91513753 CAACTTAATCAACAGATGAATGG - Intergenic
994533429 5:100996453-100996475 CAATGTATTCAAATTATGGCAGG + Intergenic
996081181 5:119259879-119259901 TAACTTTTTCAAAAGATGGCTGG + Intergenic
996276830 5:121676948-121676970 AAGTTTATTAAAAAGATGTAAGG + Intergenic
996963460 5:129279582-129279604 TAATTTATTAAAAAGATGTTGGG - Intergenic
997161274 5:131611758-131611780 GAATTTATTAACAAGATGGTTGG - Intronic
998020141 5:138762810-138762832 CATTTTATTAAAAGGAGGGATGG + Intronic
998512645 5:142726158-142726180 CAGTATATTCACAGGATGGATGG + Intergenic
998547888 5:143046773-143046795 AAATTTATTTAAAATATGTACGG - Intronic
998994978 5:147861674-147861696 CAATTTATTCACATGATGTTGGG + Intergenic
999423560 5:151466198-151466220 CATTTTATTAAAAGGAAGGAAGG - Intronic
999576923 5:152989026-152989048 CACTTTATTCAAAGGACAGAAGG + Intergenic
1000462597 5:161541520-161541542 CAATTTATGCAGAAGATGCAAGG - Intronic
1001161217 5:169316409-169316431 CAATTTATTTAATAGATACAGGG - Intergenic
1001211291 5:169812515-169812537 CAATTTTTTCACAAAACGGATGG - Intronic
1001364668 5:171124145-171124167 AAATTTATCAAAAAGATAGATGG + Intronic
1001895852 5:175380268-175380290 CAATTTCTTGAATAGATGCAGGG - Intergenic
1002700235 5:181118943-181118965 CACTTTAGGCAAAAGGTGGAAGG + Intergenic
1002771674 6:295420-295442 CAGATTATACAGAAGATGGAGGG + Intronic
1004266554 6:14153108-14153130 CAATTTCTCCAAAATTTGGAAGG - Intergenic
1004906430 6:20240656-20240678 CAATTTATTCAAAAAAGGATAGG + Intergenic
1005209743 6:23446892-23446914 TGATTTATTCAAAGGAGGGATGG + Intergenic
1005256577 6:24009899-24009921 CAATTTATTCATGAGACGAAAGG - Intergenic
1005258576 6:24031990-24032012 CAACTTCTTCATAAGATGGCAGG + Intergenic
1005279282 6:24254770-24254792 CAATTTATTCCAGAAATGCAAGG + Intronic
1006139472 6:31919648-31919670 CCATTTATGCAAAAAAAGGAGGG - Intronic
1006279261 6:33035337-33035359 AAATATATTCAAAGAATGGAAGG - Intergenic
1008269204 6:49469696-49469718 CAATTTTTGCCAAAAATGGAAGG - Intronic
1008434158 6:51455651-51455673 CATTTTATTCAGAAGAAGTATGG + Intergenic
1008484141 6:52016965-52016987 ATGTTTATTCAAAAGAAGGAGGG - Intronic
1009055780 6:58333197-58333219 CAATTTTTTAAAAAGATGAATGG - Intergenic
1009235395 6:61117401-61117423 CAATTTTTTAAAAAGATGAATGG + Intergenic
1009310315 6:62142386-62142408 AAATTTATCCGAGAGATGGAAGG - Intronic
1009432304 6:63578205-63578227 CAGTTTATTAAAAATATGTATGG + Intronic
1009795386 6:68459485-68459507 CAACTTATTCAAAAGTTAAAGGG - Intergenic
1010516469 6:76778043-76778065 CCATATATTCCAGAGATGGAAGG - Intergenic
1011087085 6:83553057-83553079 CAAATTATTTAATAGATGTATGG - Exonic
1011886603 6:92104181-92104203 CACTTTCTTCACAAGATGGCAGG - Intergenic
1013335883 6:109160815-109160837 GGATTTAGTGAAAAGATGGATGG + Intronic
1013358460 6:109369822-109369844 CAGTTTTTTAAAAATATGGAGGG + Intronic
1013727699 6:113120006-113120028 TAATTTAAGCAATAGATGGAAGG - Intergenic
1013751163 6:113408182-113408204 CAATTAATTCTAAACAAGGAAGG + Intergenic
1013893338 6:115053293-115053315 CTATTTATTCAAAGGAATGATGG + Intergenic
1014378769 6:120713038-120713060 GAATTTATCCCAAAGATGCAAGG + Intergenic
1014583880 6:123173504-123173526 CAAGTAATTCAAAAGAAGGCAGG + Intergenic
1014778053 6:125533387-125533409 CATCTTTTTCAAAAGGTGGATGG - Intergenic
1015154511 6:130076771-130076793 CACTTCACTCAAAAGTTGGAAGG - Intronic
1015514174 6:134068486-134068508 CAATCTATGAAAAACATGGAGGG + Intergenic
1016072557 6:139757371-139757393 CAATTGAATCAGAATATGGAGGG - Intergenic
1016253946 6:142081119-142081141 CTGTTTATTCAAATGGTGGAAGG + Intronic
1016731715 6:147434579-147434601 TAATTTCTTTTAAAGATGGATGG - Intergenic
1016746717 6:147588811-147588833 AAAATTAGTAAAAAGATGGATGG - Intronic
1018270980 6:162077147-162077169 CTCTTGGTTCAAAAGATGGAAGG + Intronic
1020597989 7:10235190-10235212 CAATTAATCCAAAAGAAGGAAGG - Intergenic
1021025040 7:15656163-15656185 AACTTTAATCAAAAGAAGGAAGG - Intronic
1021030835 7:15732775-15732797 CAATTTATTTAAAAGAGTTACGG + Intergenic
1021471448 7:21007222-21007244 GGATTCATTCAAAAGATGCAAGG + Intergenic
1021787031 7:24162798-24162820 CACTGTCTTCAAAAGATGGCAGG - Intergenic
1023118145 7:36882848-36882870 CATTGTTTCCAAAAGATGGAGGG - Intronic
1024505790 7:50160109-50160131 CAATTTGCTGAAAAAATGGAAGG - Intergenic
1027760959 7:82278202-82278224 CAATTTATTCAAAAGATGGAAGG + Intronic
1027972899 7:85109086-85109108 CAATTAATTAAAAACATGTATGG + Intronic
1028604454 7:92640401-92640423 CAATAGATACAAAAGAAGGATGG + Intronic
1031953096 7:127912210-127912232 AAATTTATTTAAGAGAGGGATGG - Intronic
1032044191 7:128589619-128589641 GAACTTATTAAAAAGATGGTAGG - Intergenic
1033707968 7:143906855-143906877 CAATTTATTCAAGAGAAGCTGGG - Intergenic
1034643844 7:152626489-152626511 GAAATTATTCAAAACTTGGAAGG - Intergenic
1034702001 7:153104616-153104638 CAACTTAATCAGAAAATGGAGGG - Intergenic
1035424022 7:158755032-158755054 GAATTTCATCAAAAGAAGGAGGG + Intronic
1036099946 8:5769122-5769144 GAATTTATTCCAGAGATGCAAGG - Intergenic
1038892626 8:31743658-31743680 CAATTTATAGTAAATATGGAAGG + Intronic
1040619569 8:49075716-49075738 CAATTTTTTTAAAAGAATGAAGG + Intronic
1040816776 8:51516241-51516263 CAATTTATGTAAAATATGCATGG + Intronic
1041964700 8:63662552-63662574 GAATTAATTGAAAAGGTGGATGG - Intergenic
1042045622 8:64647934-64647956 CAATGATTTCAAAAGAAGGATGG + Intronic
1043667235 8:82830352-82830374 AAATTTAATCAATAGATGAATGG + Intergenic
1043963140 8:86441111-86441133 CAATCAATTCAAAAGAAGAATGG - Intronic
1044216328 8:89615297-89615319 CAATTTATTGAAAGGATGTTGGG - Intergenic
1044812930 8:96082536-96082558 AAATTTAGTCAATAGAAGGAAGG - Intergenic
1045344921 8:101285204-101285226 TAATTTATTCAAAAATTGCAGGG - Intergenic
1045365587 8:101472831-101472853 GATTTTGTTCAAAAGAAGGAAGG - Intergenic
1045712861 8:105006173-105006195 CAATTTAGCCAACAGATGAAAGG + Intronic
1045950135 8:107842348-107842370 CTTTTTATCCAAAAGATGCAAGG - Intergenic
1046478061 8:114775146-114775168 TAATTTATTCAAAATAAGGCAGG + Intergenic
1046635969 8:116676414-116676436 CAACTTCTTCACAAGATGGCAGG + Intronic
1046716181 8:117570084-117570106 CAATTGATTAGAAAAATGGAAGG - Intergenic
1048496372 8:134939471-134939493 GAATTAATTCAAGAGGTGGATGG - Intergenic
1048517547 8:135124494-135124516 CAGTGTATGCAAAAGCTGGAAGG + Intergenic
1048890964 8:138946178-138946200 CAATTATTTCAAAAGAAGTAAGG - Intergenic
1050623494 9:7478854-7478876 TTATTTATTCAAAAGGCGGAAGG - Intergenic
1050626826 9:7512883-7512905 CAGTTTGTTGAAAAGATTGATGG + Intergenic
1051771750 9:20586615-20586637 CAAATTATTCAAACTATGGCAGG + Intronic
1052555944 9:30017585-30017607 CAATTTTTTCAAATTATGTACGG - Intergenic
1054355444 9:64056935-64056957 TAATTTATTCAAAAAAGAGAAGG - Intergenic
1055170314 9:73249561-73249583 CTATTTAATCAATAGATGTAAGG - Intergenic
1055277585 9:74636550-74636572 CAATTTATTCTCAAGAAGGAAGG + Intronic
1055543235 9:77337434-77337456 CAGTGTATTCAGAAGATGGTTGG + Exonic
1057288505 9:93781557-93781579 CAATATATGCTAAAGATGGATGG - Intergenic
1058179855 9:101784099-101784121 CAATTTCTGCCAAAGAAGGAAGG - Intergenic
1058561801 9:106237416-106237438 CAATTAGTTAAAAAGATGCATGG - Intergenic
1058936469 9:109773864-109773886 CCATTTAGTCAATATATGGAGGG + Intronic
1059124257 9:111668481-111668503 CAATTTAATAAAGAGAAGGAAGG - Intronic
1061774220 9:132949818-132949840 GAATTTATTGAAAAGATACAGGG - Intronic
1203528439 Un_GL000213v1:112647-112669 CAACTTCTTCAAAAGGTGGCAGG + Intergenic
1185686036 X:1929245-1929267 CAATTTCTTTAAAAGCTGTATGG + Intergenic
1186102867 X:6175163-6175185 CAAATTATTTCAAAGATAGATGG - Intronic
1187081988 X:15999985-16000007 AAGTCTACTCAAAAGATGGAAGG + Intergenic
1187664919 X:21596241-21596263 CAATCTATACAAGAGGTGGATGG + Intronic
1188169073 X:26899694-26899716 TAATATATTCAAAATAAGGAGGG + Intergenic
1188312710 X:28637265-28637287 CCATTTATTTAAAATTTGGAGGG - Intronic
1190377336 X:49801863-49801885 CAAATAATTCAAAAGAAGGCAGG + Intergenic
1190578713 X:51869458-51869480 CAATTTATTAAAAAGAAAGAGGG + Intronic
1190589267 X:51981747-51981769 AAATTTATTCAAAGAATGTAAGG - Intergenic
1191041324 X:56083892-56083914 CAATTTTTTCCATGGATGGAGGG - Intergenic
1191926171 X:66312394-66312416 CACTATATTCATATGATGGATGG - Intergenic
1191944179 X:66513689-66513711 AAAATTATTCAAAAGCTGAAAGG - Intergenic
1192466962 X:71364130-71364152 CAATTTATTCTGCAGAAGGATGG + Intergenic
1193109820 X:77717280-77717302 CAATTAATTTAAAACATGAAAGG - Intronic
1193551077 X:82893413-82893435 TAATTTATGCAAAGGAAGGATGG - Intergenic
1194771371 X:97909942-97909964 AAATTTATTTAATAGATAGAGGG + Intergenic
1195250735 X:103043837-103043859 CAATTTATTCAAAATAACAATGG - Intergenic
1195286772 X:103393148-103393170 GAGTTTATTCCAGAGATGGAAGG + Intergenic
1195788137 X:108550126-108550148 AAATTTATTCAGAAAATAGAGGG + Intronic
1198693092 X:139305701-139305723 AAATTTATTTAAAATATGCATGG - Intergenic
1199328557 X:146531168-146531190 CAATTTATTCATATGATGGTGGG - Intergenic