ID: 1027767312

View in Genome Browser
Species Human (GRCh38)
Location 7:82361726-82361748
Sequence ACTAATGTACGTACAGTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 62}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027767312 Original CRISPR ACTAATGTACGTACAGTTAT TGG Intronic
910296215 1:85647992-85648014 ATTATTATACTTACAGTTATAGG - Intergenic
922512545 1:226181631-226181653 AATAATGTACATACAGTTTTTGG + Intronic
924551465 1:245081810-245081832 ACTGATGTAAGTACAGTGAGGGG - Intronic
1078866613 11:15303616-15303638 AATAATGTAAGTATAGTGATGGG - Intergenic
1082660727 11:55907710-55907732 ATTAATGTATTTACAGTTTTTGG + Intergenic
1084874204 11:72118748-72118770 ACTCATGTACTTAAAATTATGGG - Intronic
1087226945 11:95611820-95611842 TCCAATGTATGTACAGTTCTAGG + Intergenic
1087471955 11:98586882-98586904 ACTAATACACGTACAGCAATAGG + Intergenic
1089307690 11:117536930-117536952 GATAATGTACGTAAAGTCATTGG - Intronic
1099132392 12:78851413-78851435 ACTAAAGTACTTGCAGTTCTTGG + Intergenic
1109031380 13:57194208-57194230 ACTTATGGACATAAAGTTATGGG - Intergenic
1110088335 13:71411207-71411229 ACTAATGCTAGCACAGTTATGGG - Intergenic
1113054535 13:106254046-106254068 ACTTATGTAAATATAGTTATAGG + Intergenic
1123460996 15:20471643-20471665 ATCAAAGTACCTACAGTTATGGG - Intergenic
1123657064 15:22528737-22528759 ATCAAAGTACCTACAGTTATGGG + Intergenic
1124271639 15:28287495-28287517 ATCAAAGTACCTACAGTTATGGG - Intronic
1124310977 15:28623913-28623935 ATCAAAGTACCTACAGTTATGGG + Intergenic
1125192478 15:37009972-37009994 ATTAATGTCCTTACAGTTAATGG + Intronic
1128419799 15:67480802-67480824 CCTAATGTACCTACAGCTCTAGG + Intronic
1128697256 15:69776480-69776502 ACTAATGAAAATACAGATATTGG - Intergenic
1138897971 16:61231846-61231868 ATAAATGTATATACAGTTATAGG + Intergenic
1156151334 18:34246890-34246912 ACAAATGTATGCACAGTCATTGG - Intergenic
1158254111 18:55526400-55526422 AATAATGTAAGAACTGTTATTGG - Intronic
1160478438 18:79216005-79216027 TCTAATGTATGTACAGTTCTAGG + Intronic
925734223 2:6946520-6946542 ATTTATGTACATACAATTATAGG - Intronic
932004533 2:67915056-67915078 ACTAATGTCCCTAGAGGTATTGG + Intergenic
939955678 2:148526210-148526232 ACTCAGGTACTTAGAGTTATTGG + Intergenic
942842152 2:180375397-180375419 ACTAATATACGTAAAGTACTTGG - Intergenic
944574414 2:201077775-201077797 AATTATGTAGGTACATTTATAGG - Intronic
1170364846 20:15587594-15587616 TGCAATGGACGTACAGTTATTGG + Intronic
951117301 3:18880054-18880076 ACTAAAGTACTTTCAATTATTGG - Intergenic
953309932 3:41866793-41866815 AATAATGTACTAACAGATATAGG + Intronic
958092067 3:88889560-88889582 ACTAAGGTATGTACATTTTTTGG + Intergenic
965347090 3:167564849-167564871 ACTAAAGTGCCTACTGTTATTGG - Intronic
971143400 4:23949382-23949404 ACTAAATTACGTACAGGTAGCGG + Intergenic
987593152 5:19959345-19959367 ACTAATGTATATTTAGTTATGGG + Intronic
987652370 5:20759092-20759114 CCTAATGAAAGTATAGTTATTGG + Intergenic
988743189 5:34102388-34102410 CCTAATGAAAGTATAGTTATTGG - Intronic
989546298 5:42677884-42677906 ACTAATGAACTTATAGTTACAGG + Intronic
990516985 5:56539443-56539465 ACTAATCTAAGTACTGCTATGGG + Intronic
992132842 5:73711144-73711166 ATTAATATATGTACATTTATAGG + Intronic
993914947 5:93732905-93732927 ATAAATGTATGTACAGGTATTGG - Intronic
995132386 5:108644234-108644256 AGTAATGTAAGTACAGGTAGGGG + Intergenic
996812295 5:127530388-127530410 ACTTATGTACATACTGATATAGG - Exonic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
999039700 5:148393827-148393849 AATAATGTTGGTACAGATATAGG - Intronic
1003691592 6:8359816-8359838 ATTAAAGTAGGTACAGTTTTAGG - Intergenic
1005675136 6:28146292-28146314 ACTAATAAATATACAGTTATGGG + Intronic
1008065372 6:47042162-47042184 AGTAATCAAAGTACAGTTATTGG + Intronic
1014735594 6:125092701-125092723 ACTATTGTGCCTACAGTTACTGG + Intergenic
1015075070 6:129147043-129147065 ACAAATGTATGTATATTTATAGG + Exonic
1015264177 6:131273717-131273739 ACTTACGTATGTACAGTTTTTGG + Intronic
1015978684 6:138817387-138817409 ATTAATTTATTTACAGTTATTGG - Intronic
1027453129 7:78355689-78355711 ACTTATGTATGTACAGACATGGG + Intronic
1027767312 7:82361726-82361748 ACTAATGTACGTACAGTTATTGG + Intronic
1029847555 7:103428275-103428297 ACTAATTTCTGTACAGTGATTGG + Intronic
1032985932 7:137337212-137337234 TCCAATGTATGTACAGTTAGAGG - Intronic
1046163108 8:110393039-110393061 ATTAATGTAAGGACAGATATTGG + Intergenic
1048776658 8:137954184-137954206 ACTAATACAAGTACAATTATTGG - Intergenic
1050331145 9:4547522-4547544 ACTAGTGTTGGCACAGTTATAGG + Intronic
1051835802 9:21335997-21336019 ACTATAGTATGTATAGTTATTGG - Intergenic
1061623810 9:131828562-131828584 GCGAATGTAAGTACACTTATTGG - Intergenic
1186635697 X:11401997-11402019 AATGATGTACATAAAGTTATTGG - Intronic
1193686691 X:84585093-84585115 AATAAAGTACATACAGTAATTGG - Intergenic
1194358827 X:92921444-92921466 AGTAATGTATGTACAGTGCTTGG - Intergenic