ID: 1027767366

View in Genome Browser
Species Human (GRCh38)
Location 7:82362548-82362570
Sequence CTGCAGTAATGGAGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027767360_1027767366 10 Left 1027767360 7:82362515-82362537 CCATTAGAATTCACACTACCTGT 0: 1
1: 1
2: 0
3: 6
4: 139
Right 1027767366 7:82362548-82362570 CTGCAGTAATGGAGGAAAAAAGG No data
1027767362_1027767366 -8 Left 1027767362 7:82362533-82362555 CCTGTTTTAGGTCACCTGCAGTA 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1027767366 7:82362548-82362570 CTGCAGTAATGGAGGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027767366 Original CRISPR CTGCAGTAATGGAGGAAAAA AGG Intronic
No off target data available for this crispr