ID: 1027772495

View in Genome Browser
Species Human (GRCh38)
Location 7:82425183-82425205
Sequence GGGGCTCAATACCCCTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027772495 Original CRISPR GGGGCTCAATACCCCTTTGA AGG (reversed) Intronic
900853702 1:5163867-5163889 GGGGCTTAATACCTCGGTGATGG - Intergenic
902491552 1:16786015-16786037 GGGGTTCAATTCCCTTGTGAAGG - Intronic
906933254 1:50189789-50189811 GGGGGTCAATTATCCTTTGATGG - Intronic
920835079 1:209502993-209503015 GGGGCACCACACCCATTTGAGGG - Intergenic
922364606 1:224852035-224852057 GGTACTGAATACACCTTTGATGG + Intergenic
923528895 1:234796527-234796549 GGGGTTCAATTCCCTTGTGAAGG + Intergenic
1065657387 10:27965686-27965708 GGGTGTCAATAACCCTTTTATGG - Intronic
1070831894 10:79422816-79422838 GGTACTCATTACTCCTTTGAGGG - Intronic
1071404323 10:85315433-85315455 AGGGCTCAATACAGATTTGAAGG + Intergenic
1071525219 10:86354428-86354450 GGGGCTCATTCTCCCATTGAGGG - Intronic
1078151600 11:8764303-8764325 AGGGCTCAATTTCCCTTTGGAGG + Intronic
1079349168 11:19678117-19678139 GGGACTCAACTCCCCTCTGAAGG - Intronic
1079764174 11:24369966-24369988 TGGGCTTAATACCTATTTGATGG - Intergenic
1079912713 11:26331224-26331246 TGGGCTCAATACCCGGGTGATGG + Intronic
1080719348 11:34834144-34834166 GGGGCTTAATACCCAGGTGATGG - Intergenic
1081274134 11:41126085-41126107 GGGGCTTAATACCCAGGTGATGG + Intronic
1081582271 11:44360459-44360481 GGGGCCCCATTCCCCTTTGGAGG - Intergenic
1084600087 11:70140129-70140151 GTGGCTCAAGACCCCTTTCTGGG - Intronic
1087404343 11:97711573-97711595 GGGGCTCAATACCTAGGTGATGG + Intergenic
1087520633 11:99230754-99230776 GGGGCTTAATACCTATGTGATGG - Intronic
1091501196 12:1019599-1019621 GGTGCTCAAGACCCCCTTGCAGG - Intronic
1098172607 12:67762081-67762103 GGGGATCAATATCACTTTAAAGG - Intergenic
1102255325 12:111411671-111411693 GGCCCTCAATAGCCCTTTGGTGG + Intronic
1103428269 12:120857864-120857886 GGGGCTTAATACCTCGGTGATGG + Intronic
1103970450 12:124667536-124667558 GGGGCAAAATAAACCTTTGAAGG + Intergenic
1108330934 13:49382374-49382396 AGGATTCAATATCCCTTTGAAGG + Intronic
1108770725 13:53697554-53697576 GGGGTTCAATACCTCTGTGGAGG + Intergenic
1109004340 13:56852321-56852343 GGGGTTCATCTCCCCTTTGAAGG - Intergenic
1110313934 13:74083213-74083235 CGGCCTCAATACATCTTTGATGG - Intronic
1110715973 13:78704515-78704537 GGGGCTTAAAACCCATATGATGG + Intergenic
1111828443 13:93297343-93297365 GGGGCTTAATACCCAGGTGATGG + Intronic
1112003027 13:95229287-95229309 GGGACTCAACACACCTTAGAAGG + Intronic
1113012706 13:105788560-105788582 GGGGCTTAATACCTCAGTGATGG - Intergenic
1116685116 14:48029179-48029201 GGGTATCAAGATCCCTTTGAAGG + Intergenic
1121251886 14:92505727-92505749 TGGGCTCAACAACCCTTTGCAGG - Intergenic
1121789774 14:96690362-96690384 AGGGCTCACCACCCCTTGGATGG + Intergenic
1123477558 15:20600787-20600809 GGGGCTTAATACCTATGTGATGG - Intergenic
1123640458 15:22399595-22399617 GGGGCTTAATACCTATGTGATGG + Intergenic
1124359819 15:29028093-29028115 GGGGCTTAATACCTCGGTGATGG - Intronic
1129065862 15:72903228-72903250 GGGGCTAAAGAGCCCTTTGCTGG - Intergenic
1130908255 15:88254693-88254715 GTGGCTCTTTACCCCTTCGACGG - Intronic
1135250483 16:20897395-20897417 GGGGCTCAATTCCACTGTGTCGG - Intronic
1135288525 16:21214581-21214603 GGGGCTCAATACCTAGGTGATGG + Intergenic
1137474027 16:48791153-48791175 GGGGCTCAATACCTAGGTGATGG - Intergenic
1138248597 16:55485304-55485326 GGCGATGGATACCCCTTTGACGG + Exonic
1138807100 16:60103155-60103177 GGGGCTTAATACCTATGTGATGG - Intergenic
1141126605 16:81404985-81405007 GGGGCTCAATACCTAGGTGATGG - Intergenic
1141867516 16:86760913-86760935 GGGGAGCAAGACCCCTTTCACGG + Intergenic
1143527072 17:7479162-7479184 GGTGCTCACTCCCTCTTTGAAGG - Intronic
1144250782 17:13414615-13414637 GGGGCTCAATACCTAGGTGATGG - Intergenic
1144646012 17:16974045-16974067 AGGGCTAAAGTCCCCTTTGACGG - Intergenic
1145251284 17:21298239-21298261 GGGCCTCCTTCCCCCTTTGAAGG + Intronic
1147995613 17:44358793-44358815 GGGGCTCCATTCCGCTTAGAGGG - Intronic
1149109868 17:53015627-53015649 TGGGCTTAATACCTATTTGATGG + Intergenic
1149668149 17:58380904-58380926 GGGGCTTAGAAGCCCTTTGAGGG + Intronic
1150415512 17:64985108-64985130 GAGGCTCAATTCACCTTTAATGG + Intergenic
1150580549 17:66469986-66470008 GGGGGTAATTACCCCTTGGAAGG - Intronic
1160493228 18:79355066-79355088 GGGGCTCATTACCCCTTCACTGG - Intronic
1161953888 19:7482409-7482431 GGTGCTCAGTGCCCCTTGGAGGG + Intronic
1164291729 19:23875696-23875718 GGAGCACAAGACCCTTTTGAAGG + Intergenic
1167202252 19:48074076-48074098 GGGGCTTAATACCTATGTGATGG - Intronic
927014656 2:18946233-18946255 GGGGCTTAATACCTCAGTGATGG - Intergenic
928990859 2:37231858-37231880 GGGGCTCACTTCCACCTTGAAGG + Intronic
930350732 2:50251126-50251148 GGGGCTCAATACCTAGGTGATGG - Intronic
930736430 2:54784772-54784794 GGGGCTTAATACCTCGATGATGG - Intronic
932873400 2:75426097-75426119 GGGGCTTAATACCCAGGTGATGG - Intergenic
933622023 2:84554164-84554186 AGGGCTCAATCCCTCTTTTAAGG + Intronic
935460741 2:103330571-103330593 GGGGCTTAATACCTCGGTGATGG - Intergenic
937139964 2:119591417-119591439 GGTGCTCAATATACCCTTGATGG + Intronic
937562444 2:123242451-123242473 GGGGCTTAAAACCCATATGATGG + Intergenic
939706660 2:145462456-145462478 GGGGCTTAATACCTATGTGATGG - Intergenic
941743244 2:169058847-169058869 GGGGCTTAATACCTAGTTGAAGG + Intergenic
944848671 2:203694741-203694763 GGGGCTCAATAAATCTTTGTTGG - Intergenic
945750053 2:213770555-213770577 GGGGCTTAATACCTATGTGATGG - Intronic
947014581 2:225604385-225604407 GGGGCTCAATAACTATTTGCTGG + Intronic
947432755 2:230045131-230045153 CGGGCTCCTTACCCATTTGAAGG - Intronic
1170817564 20:19727738-19727760 TGGGCTGATTACCCCTTTGCTGG - Intergenic
1171377473 20:24703190-24703212 GGGGCTCCATCCCCCAGTGATGG - Intergenic
1173457987 20:43219081-43219103 GGAGCTCAATTCCCCTTTCCTGG + Intergenic
1180027908 21:45178834-45178856 AGGGCTCAGCACCCCGTTGAGGG - Intronic
1181063197 22:20291806-20291828 GGGGTGCAAGACCCCTTTGCTGG - Intergenic
1184200940 22:42968910-42968932 GGGGCTCAGTCCACATTTGAGGG - Intronic
950568513 3:13785997-13786019 GGGGCTGAAGGCCCCTTTGGGGG - Intergenic
952072079 3:29649311-29649333 GGGGCACAATTTCCATTTGATGG + Intronic
952360021 3:32621299-32621321 TGGTATCAATCCCCCTTTGAAGG + Intergenic
954070334 3:48138462-48138484 GGGTCTCAACACCCCTGTGGAGG + Intergenic
954469471 3:50679753-50679775 GGGCCCCAATACCCCTTTAGAGG + Intronic
955212982 3:56959338-56959360 GGGGCTAAATGTCCCGTTGATGG - Intronic
955927589 3:64023170-64023192 GGAGCTCCAGACCCCTCTGACGG - Intronic
957902082 3:86507602-86507624 AGGGCTCAATACCTATGTGATGG - Intergenic
959739914 3:109706086-109706108 GGGGCTCAATACCTAGGTGATGG - Intergenic
960764081 3:121106346-121106368 AGGGCTCAATACCGATGTGATGG - Intronic
962089364 3:132227122-132227144 GGGGCTTAATACCCAGGTGATGG - Intronic
962334575 3:134515868-134515890 GTGGCCCAATACAGCTTTGAAGG - Intronic
965899655 3:173623008-173623030 GGGACTCAACACTCCCTTGAGGG - Intronic
970129031 4:12845991-12846013 GGGTCTCAACAGCCCTTGGAGGG + Intergenic
974535620 4:63170083-63170105 GGGACTCAATAATCCTTTCAGGG - Intergenic
977712380 4:100142326-100142348 GTGCCTCAATACTACTTTGAAGG + Intergenic
982617594 4:157659733-157659755 GGGGCTTAATACCCAGGTGATGG + Intergenic
987457151 5:18162114-18162136 GGGGTTTAATACCTCTGTGATGG - Intergenic
988684998 5:33517495-33517517 GGGGATCAATAGCTCTTTTATGG - Intergenic
995503580 5:112834958-112834980 GGCACTCAATACGCTTTTGAGGG - Exonic
996506054 5:124268759-124268781 GGGGCTCAATACCTAGGTGATGG - Intergenic
998547718 5:143045417-143045439 AGGGCTCTAGACCCCTTTGAAGG + Intronic
999918408 5:156289401-156289423 GGGGCTTAATACCCAGGTGATGG - Intronic
1000137102 5:158363568-158363590 GGGACTCAATGTCCCTGTGATGG - Intergenic
1002494974 5:179605602-179605624 GGGGCTCAAAAAGACTTTGAGGG - Intronic
1003285973 6:4734268-4734290 TGGGCTCAAGAGACCTTTGAGGG + Intronic
1010708213 6:79139571-79139593 GGGGCTTAATACCCAGGTGATGG + Intergenic
1014127585 6:117794710-117794732 GGGGCTAACTCCCCCTTTCATGG + Intergenic
1021236875 7:18153321-18153343 GGGGCTCAAGAGCCCTGTTATGG + Intronic
1021391220 7:20095158-20095180 GGGGCTTAATACCTAGTTGATGG + Intergenic
1026246819 7:68627897-68627919 GGGGATCAATAGCCCCTTGCTGG - Intergenic
1026304299 7:69126648-69126670 GGGGCTTAATACCTATGTGATGG + Intergenic
1026504419 7:70970070-70970092 CGGGCTCAATATCCCTTTAGCGG - Intergenic
1027772495 7:82425183-82425205 GGGGCTCAATACCCCTTTGAAGG - Intronic
1034266756 7:149784874-149784896 GGGGCAGAATGCCCCTGTGAAGG - Intergenic
1040327057 8:46352871-46352893 GTGCCTAAATATCCCTTTGAAGG + Intergenic
1040457526 8:47613959-47613981 GGGGCTTAATACCCAGGTGATGG - Intronic
1040739913 8:50560763-50560785 GGGGCTCAATACCTGTATGAGGG + Intronic
1042523155 8:69735717-69735739 GGGGCTTAATACCCAGGTGATGG + Intronic
1043548412 8:81340870-81340892 TGGGCTCAATAACTCTATGAAGG + Intergenic
1045456495 8:102384909-102384931 GGGACTCAGTAACCCTTTGTTGG - Intronic
1056814445 9:89791480-89791502 GGGGCTTAATACTCCTCTCAGGG + Intergenic
1185769658 X:2755933-2755955 GGGGCTTAATGCCTCTGTGACGG + Intronic
1186138244 X:6543071-6543093 GGGGCTTAATACCTGGTTGATGG - Intergenic
1186552998 X:10526890-10526912 GGGGCTGACAACACCTTTGAAGG + Intronic
1187078334 X:15958996-15959018 GGGGCTTAATACCTATGTGATGG - Intergenic
1191026795 X:55922511-55922533 GGGGCTTAATACCTATGTGATGG + Intergenic
1193900938 X:87176510-87176532 GGGGCTTAATACCTAGTTGATGG - Intergenic
1196559757 X:117131263-117131285 TGGGCTCAATACCTATGTGATGG + Intergenic
1201300856 Y:12503696-12503718 GGGGCTTAATGCCTCTGTGACGG - Intergenic