ID: 1027773964

View in Genome Browser
Species Human (GRCh38)
Location 7:82443146-82443168
Sequence CTCGGGCGCCTCCACGGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027773964_1027773975 11 Left 1027773964 7:82443146-82443168 CCGGCCCCGTGGAGGCGCCCGAG 0: 1
1: 0
2: 1
3: 8
4: 172
Right 1027773975 7:82443180-82443202 GGACGCATTCCAGCGGCGAGCGG 0: 1
1: 0
2: 0
3: 0
4: 38
1027773964_1027773974 4 Left 1027773964 7:82443146-82443168 CCGGCCCCGTGGAGGCGCCCGAG 0: 1
1: 0
2: 1
3: 8
4: 172
Right 1027773974 7:82443173-82443195 CGGTTCGGGACGCATTCCAGCGG 0: 1
1: 0
2: 0
3: 1
4: 29
1027773964_1027773977 29 Left 1027773964 7:82443146-82443168 CCGGCCCCGTGGAGGCGCCCGAG 0: 1
1: 0
2: 1
3: 8
4: 172
Right 1027773977 7:82443198-82443220 AGCGGCGCGCACCGCCTGCCCGG 0: 1
1: 0
2: 0
3: 7
4: 106
1027773964_1027773970 -10 Left 1027773964 7:82443146-82443168 CCGGCCCCGTGGAGGCGCCCGAG 0: 1
1: 0
2: 1
3: 8
4: 172
Right 1027773970 7:82443159-82443181 GGCGCCCGAGACGCCGGTTCGGG 0: 1
1: 0
2: 1
3: 5
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027773964 Original CRISPR CTCGGGCGCCTCCACGGGGC CGG (reversed) Intronic
900158218 1:1211943-1211965 CCCGGGGACCTCCACGGGCCGGG + Exonic
900517549 1:3090185-3090207 CCCGAACGCCACCACGGGGCTGG + Intronic
900556929 1:3285246-3285268 GGCAGGGGCCTCCACGGGGCTGG - Intronic
901328130 1:8381710-8381732 CACTGGCGCGTCCCCGGGGCTGG - Intronic
901680959 1:10912645-10912667 CTCAGGCGCCTCCGCCGGCCTGG + Intergenic
902435118 1:16393443-16393465 CTCCTGCTCCTCCTCGGGGCTGG - Exonic
911002349 1:93179902-93179924 CTCGCGCGCCTGCGCGGAGCGGG + Intronic
921355448 1:214281069-214281091 CTCGCGCGCCCCCGCGGGGAGGG - Intergenic
922505250 1:226122226-226122248 CCCGGGCGGCTCCACGCGTCGGG + Intergenic
1062947977 10:1475161-1475183 CTCAGGAGCCCCCCCGGGGCAGG + Intronic
1064785346 10:18888379-18888401 CCCGGACCCCTTCACGGGGCTGG - Intergenic
1065114983 10:22476401-22476423 CTCGGGCGCATCCCCCAGGCCGG + Intergenic
1070752691 10:78973538-78973560 GTCGGGCCCCTCCGCGGGGCGGG - Intergenic
1072591586 10:96832614-96832636 TCCGCGCGCCTCCCCGGGGCTGG + Intronic
1073412173 10:103351125-103351147 CTCGGACGCCACCACTGCGCAGG + Exonic
1076215170 10:128687373-128687395 CTGGGACCCCTCCCCGGGGCAGG - Intergenic
1076821543 10:132942355-132942377 GTCCGGGGCCTCCCCGGGGCGGG + Intronic
1076947953 10:133664851-133664873 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076948943 10:133668161-133668183 CCCGGACGCCTCCGCGCGGCAGG + Exonic
1076949927 10:133671460-133671482 CCCGGACGCCTCCGCGCGGCAGG + Exonic
1076950911 10:133674759-133674781 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076951901 10:133678069-133678091 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076952890 10:133681379-133681401 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076953874 10:133684678-133684700 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076954858 10:133741030-133741052 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076955847 10:133744340-133744362 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076956837 10:133747650-133747672 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076957824 10:133750959-133750981 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076958809 10:133754258-133754280 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076959798 10:133757568-133757590 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076960782 10:133760867-133760889 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1077078247 11:710873-710895 CCCGGGCTCAGCCACGGGGCCGG + Intronic
1077478261 11:2801171-2801193 CTGGGGAGCCTCTAGGGGGCTGG - Intronic
1078474644 11:11620590-11620612 CCCGGGCGGCTCCGCGGGGAAGG + Intronic
1078514369 11:12009405-12009427 CTGCGGCCCCTCCGCGGGGCGGG - Intronic
1082802812 11:57426984-57427006 CTCGGGCTCCTCTGCGGGGAGGG - Intronic
1083571099 11:63762818-63762840 CTCGGGAGCCTTCCCGGGGTGGG - Exonic
1083674520 11:64318092-64318114 CTGGGCCGCCTCCACTGCGCAGG - Exonic
1084833626 11:71787526-71787548 CTCGGGCGCCATGACGGGGGCGG - Exonic
1096114726 12:49049167-49049189 CATGGGCTCCTCCACGAGGCCGG + Exonic
1096677316 12:53232600-53232622 CTCTGGCGCCTCCCCAGGGTAGG + Intronic
1101372034 12:104138554-104138576 CTGAGGCACCTCCACGTGGCGGG - Intergenic
1102084421 12:110124393-110124415 CCCGGGCGCCTCCTGGGGGGTGG + Exonic
1104949805 12:132434300-132434322 CACGGGTGCAGCCACGGGGCTGG + Intergenic
1106208308 13:27620113-27620135 CCCGGGCGCCTGCAGGCGGCGGG + Intronic
1112402181 13:99086670-99086692 CCGGGCCGCCTCCTCGGGGCGGG + Intergenic
1113899622 13:113788914-113788936 GTCGGTGGCCTCCACGAGGCAGG - Intronic
1114516393 14:23302460-23302482 CTCCGGCTCCTCCTCGAGGCTGG + Exonic
1117072459 14:52069089-52069111 CGCGGGCGCCTGGGCGGGGCGGG + Intronic
1118628803 14:67684167-67684189 CTGGGGCTCCTCCACAAGGCTGG + Intronic
1121535735 14:94689665-94689687 CTCTGGCGCCGCCTCGTGGCGGG - Intergenic
1122771490 14:104099826-104099848 CCCTGGAGCCTCCCCGGGGCTGG - Intronic
1124957188 15:34367206-34367228 CTCGGCCGCCTGCACCGGGCGGG - Exonic
1125757058 15:42071276-42071298 CTCGGGGACCTCCTCGCGGCTGG - Exonic
1127606487 15:60592359-60592381 CCCGGGCGCCCCGCCGGGGCCGG - Intronic
1129115749 15:73364523-73364545 CCCGGGCTCCTCCCCGAGGCTGG - Intronic
1132985685 16:2766100-2766122 CTAGAGCGTTTCCACGGGGCTGG - Exonic
1134092643 16:11399701-11399723 CCTGGCCGCCTCCCCGGGGCAGG - Exonic
1134684376 16:16148432-16148454 CTGGGGCGCCCCCAGGGAGCTGG + Intergenic
1135582612 16:23641229-23641251 CTGGGGCGCCTCCCCGGCCCAGG - Exonic
1138443756 16:57050441-57050463 CTCCGGGGCCTCCAAGGGCCTGG - Intronic
1141579324 16:84986479-84986501 CTCGTAGGCATCCACGGGGCTGG + Intronic
1142237951 16:88931532-88931554 CTCTGGCTCGTCCACGGGGCCGG - Intronic
1142237965 16:88931573-88931595 CTCTGGCTCATCCACGGGGCCGG - Intronic
1142237979 16:88931614-88931636 CTCTGGCTCGTCCACGGGGCCGG - Intronic
1142336118 16:89490421-89490443 CTCGGGCGCGCCCACGGCTCGGG + Exonic
1142594394 17:1022486-1022508 CTCCGGCGCCTCCTCGAGGGAGG - Intronic
1143138807 17:4728646-4728668 CTCAGGCCCCTCCAAGTGGCTGG + Intergenic
1143503889 17:7353424-7353446 CTCGGGGAGTTCCACGGGGCGGG - Exonic
1148555523 17:48576730-48576752 CGCGGGGGCCTCCATTGGGCCGG + Exonic
1149772558 17:59332489-59332511 CGCGAGCGCCTCCCCGGAGCTGG + Intronic
1151329465 17:73398343-73398365 GTCGGGCACCTCCATGGAGCGGG + Exonic
1151472315 17:74326081-74326103 CTCGGGGGCCTCCTCGGCGGAGG + Intergenic
1151660521 17:75515941-75515963 CACGAGCGCCTCCTCGAGGCTGG - Intergenic
1151740593 17:75979331-75979353 CTCGGGAGCCTCCCCTGGCCAGG - Exonic
1151797071 17:76353550-76353572 CACGGCCGCCTGCACGGAGCTGG - Exonic
1151805000 17:76399766-76399788 ATCGGGCGTCTCCTCAGGGCTGG + Exonic
1152417481 17:80171939-80171961 CTCGGGTGCCTTCCTGGGGCTGG - Intronic
1152700870 17:81818418-81818440 CTCTGGCAACTCCATGGGGCAGG - Intergenic
1160371302 18:78373960-78373982 CTCGGGCCTGCCCACGGGGCTGG - Intergenic
1161028289 19:2046590-2046612 CTCGGGCCCCTCACCAGGGCGGG + Exonic
1161050907 19:2163795-2163817 GGCGGGCGAGTCCACGGGGCGGG + Intronic
1161118729 19:2513351-2513373 CCCGACCCCCTCCACGGGGCTGG - Exonic
1161791837 19:6364618-6364640 CCCGGGCGCCTCCTGAGGGCTGG - Exonic
1161973288 19:7595810-7595832 CCTGGGCTCCTCCCCGGGGCGGG + Intergenic
1163111232 19:15161773-15161795 CTCGGGCTCCCCCAAGAGGCTGG - Intronic
1163138648 19:15331963-15331985 CGCGGGCGCCGCGGCGGGGCCGG - Intronic
1163463536 19:17453602-17453624 CTCTGGCGCCCCCTCGCGGCAGG - Intronic
1163488733 19:17605123-17605145 CTCGGCCTCCTCCAAGGGGTGGG - Exonic
1163522211 19:17798084-17798106 CTCGGGTTCCTCCACAGGCCAGG + Intronic
1163681259 19:18683887-18683909 GTCCGGCGCGTGCACGGGGCGGG + Intronic
1165129508 19:33622926-33622948 CTGGGGCGGCTCCAGGGGGCGGG + Intronic
1166170630 19:41025602-41025624 CACGGCACCCTCCACGGGGCAGG - Intergenic
1166178437 19:41090543-41090565 CACGGCAACCTCCACGGGGCAGG + Exonic
1166291138 19:41864289-41864311 CTCTGGCTCCTGCATGGGGCTGG + Intronic
1168309442 19:55453054-55453076 CCCGGGCCACTTCACGGGGCGGG - Exonic
925068797 2:950704-950726 GAGGGGCGCTTCCACGGGGCGGG - Intergenic
926095762 2:10080029-10080051 GTCGGGGGGCGCCACGGGGCTGG + Exonic
930329263 2:49961989-49962011 CTCGGCCTCCTCCAGGTGGCTGG - Intronic
933858495 2:86441628-86441650 CCCGGGCGGCCCCACGGGGGAGG - Intronic
937125911 2:119474877-119474899 CTCCTGAGCCTCCACAGGGCAGG - Intronic
942653865 2:178194822-178194844 CGGGGGCGCCTCCAGGGGGACGG - Intronic
947506585 2:230712769-230712791 CTCGGGCGCCCCCGAGCGGCCGG - Intergenic
947605060 2:231480910-231480932 CTCTGGCCCCTCCCCAGGGCTGG + Intronic
948642590 2:239385112-239385134 CCCGGCCGCCTCCACAGGACTGG + Intronic
1169512363 20:6278003-6278025 GTCGGGTGCATCCACCGGGCTGG + Intergenic
1171123075 20:22582287-22582309 CTCGAGCGCCTCCCCGTGCCAGG - Exonic
1171870660 20:30521902-30521924 CTCGGGCCCCCCAACAGGGCGGG + Intergenic
1175429262 20:58890969-58890991 CGCGGGCGCCGCCGAGGGGCTGG - Intronic
1175985700 20:62763253-62763275 CTCAGTAGCCTGCACGGGGCTGG - Intergenic
1176124342 20:63468791-63468813 CTCTGGCCACTCCACGTGGCTGG + Intronic
1180870595 22:19144579-19144601 CTCGGGGGCCTGGACGCGGCGGG + Exonic
1180960592 22:19760704-19760726 GCGGGGCGCCTCCTCGGGGCCGG + Intronic
1181127022 22:20708541-20708563 CCCGGGCGCCACCTGGGGGCAGG + Intronic
1181240356 22:21473844-21473866 CCCGGGCGCCACCTGGGGGCAGG + Intergenic
1181419575 22:22788637-22788659 CTGGGGAGCTTCCACAGGGCTGG + Intronic
1181668959 22:24416900-24416922 CTCGGGCCCCTCCTTGGGGAAGG + Exonic
1182729402 22:32475034-32475056 CTCGGGCACCTCCAGCGGCCAGG - Exonic
1184354400 22:43969391-43969413 CTCTGGGGCCTGCACAGGGCTGG - Intronic
1184894277 22:47397961-47397983 CTCCAGTGCCTCCACGGGTCAGG - Intergenic
1185376351 22:50484250-50484272 CACGGAGGCCTCCACAGGGCAGG - Exonic
950570455 3:13796557-13796579 CTAGGGCGGCCCCACAGGGCAGG - Intergenic
953947554 3:47163300-47163322 CGCGGGCCCCTCCACGGCCCGGG + Intronic
954378113 3:50205457-50205479 CTGGGGCGCCTGCCCGGGTCAGG - Intronic
955365463 3:58306477-58306499 CCCGGGCGCATGCGCGGGGCGGG + Intronic
958004279 3:87792754-87792776 CAGGGGCGACCCCACGGGGCGGG - Intergenic
967694424 3:192514904-192514926 CCCGGGCGCCGGCAGGGGGCGGG + Intronic
968003725 3:195225258-195225280 CTCAGGGGGCTCCACTGGGCAGG - Intronic
968230657 3:197003056-197003078 CTCGGGCGACACCGCGGGGCGGG + Exonic
968869319 4:3233539-3233561 CTCGGGCACCTCCAGCGAGCTGG + Intronic
985315985 4:188659297-188659319 ATCGCGCGCCCCCACGCGGCGGG - Intergenic
985456347 4:190082128-190082150 CCCGGACGCCTCCGCGCGGCAGG + Exonic
985567071 5:624388-624410 CTGGGGCATCTACACGGGGCAGG - Intronic
985622179 5:961470-961492 CTCTGAAGCCTCCACAGGGCTGG + Intergenic
985896196 5:2751242-2751264 CTCGGCGGCCTTCACGGCGCAGG - Exonic
986813668 5:11385191-11385213 CTCGGGCCCCGCCAGGTGGCCGG + Exonic
988554063 5:32221324-32221346 CTCGGGAGTCCCCAGGGGGCTGG + Intergenic
992005575 5:72474275-72474297 CTCAGGCTCCTGCACGGAGCTGG + Intronic
992473181 5:77077501-77077523 CTCGGGGGCCGCAGCGGGGCCGG + Exonic
994083324 5:95731546-95731568 CTCGCGCGCCTCCACCGCGGCGG - Exonic
994171402 5:96662602-96662624 CCCCGGCGCCCCCGCGGGGCAGG + Intronic
996715896 5:126587835-126587857 CTGGGGCTCCTCCCTGGGGCAGG - Intronic
998128439 5:139639189-139639211 CTCCAGCCCCTCCAGGGGGCTGG - Intergenic
1001991002 5:176115317-176115339 CACGGGCACCTTCAGGGGGCTGG - Intronic
1002225870 5:177722823-177722845 CACGGGCACCTTCAGGGGGCTGG + Intronic
1002267977 5:178048389-178048411 CACGGGCACCTTCAGGGGGCTGG - Intronic
1002784848 6:392906-392928 CCCGGGCGCATCCCCTGGGCGGG - Intronic
1002927560 6:1613980-1614002 CGCGGGTGTCTCCTCGGGGCAGG + Intergenic
1004606537 6:17200472-17200494 CTCGGGCGCCTCCTCGGCCTCGG + Intergenic
1006706760 6:36027523-36027545 CTCGCGCGCCTCACCGTGGCCGG - Intergenic
1008092593 6:47308742-47308764 CTCCGGCGCCTCCAAAGCGCCGG - Intronic
1015626346 6:135183112-135183134 CTCGGCCGCCCCCGCGGGGCGGG + Intronic
1016994923 6:149954765-149954787 CTCCGGGGTCTCCACAGGGCAGG + Intergenic
1017003686 6:150014671-150014693 CTCCGGGGTCTCCACAGGGCAGG - Intergenic
1017877422 6:158536469-158536491 CTCAGGCCTCTTCACGGGGCGGG + Exonic
1017913936 6:158818353-158818375 CTCGGGCGCCTCCTCGCCGGGGG - Intronic
1018686407 6:166307767-166307789 CGCGGGCACCTCCTCGGGGGCGG - Exonic
1020107167 7:5427532-5427554 CTCGGCCCCCTACACCGGGCTGG + Intergenic
1022090066 7:27102219-27102241 CTCGGGCGGCTGCAGGGCGCCGG + Exonic
1023866231 7:44239598-44239620 CTCCGGCACCACCATGGGGCTGG - Exonic
1024748188 7:52431379-52431401 CTCAGCCCCCTCCACAGGGCAGG - Intergenic
1025974238 7:66356912-66356934 CTCGGGCTCTTGCAGGGGGCTGG + Intronic
1026516590 7:71078211-71078233 CTCAGCTGCCTCCGCGGGGCAGG + Intergenic
1026960759 7:74405794-74405816 CCCGGGCGGCCACACGGGGCGGG - Exonic
1027773964 7:82443146-82443168 CTCGGGCGCCTCCACGGGGCCGG - Intronic
1029640161 7:101815651-101815673 CTCCAGCGCCCCCTCGGGGCCGG + Intergenic
1035732390 8:1862211-1862233 CTCTGGAGCCTCCCTGGGGCGGG + Intronic
1035820789 8:2589451-2589473 CTCTGGGGCCTCCAGGGAGCTGG - Intergenic
1036722823 8:11192871-11192893 CTCAGGCCCCTCCAGAGGGCAGG - Intronic
1036767931 8:11560703-11560725 CCTGGGTGCCCCCACGGGGCAGG + Intronic
1037390474 8:18387094-18387116 CTCGGGCGCCCCCACGAGGCCGG + Intergenic
1038147698 8:24913680-24913702 GGCCGCCGCCTCCACGGGGCGGG + Exonic
1042611554 8:70607442-70607464 CTGGCGCGCCTCCACTGCGCCGG + Intronic
1044963938 8:97557136-97557158 CTCAGCCGCCTCCGCAGGGCAGG + Intergenic
1049554728 8:143276131-143276153 CTCGGGCGCACCCTCGGGCCCGG - Exonic
1049801624 8:144520393-144520415 CACGCGCACCTCCACGGGGATGG - Exonic
1049828675 8:144686032-144686054 CTCTGGCGCGGCGACGGGGCGGG - Intergenic
1053072036 9:35107475-35107497 CCCCGGCGCCTCCGAGGGGCTGG + Exonic
1057592417 9:96383757-96383779 CTCGGGCGCTCGCAGGGGGCGGG - Intergenic
1059123276 9:111661545-111661567 CGCGGGTGCCGCCCCGGGGCGGG - Exonic
1061913794 9:133738628-133738650 CTCGGGCGGCTCCAGCAGGCAGG - Intronic
1062435127 9:136543633-136543655 TTGGGGCGCCTCCTCTGGGCGGG - Intronic