ID: 1027778947

View in Genome Browser
Species Human (GRCh38)
Location 7:82499711-82499733
Sequence ACCGGCCGGCCCGCAAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027778936_1027778947 29 Left 1027778936 7:82499659-82499681 CCAGCGCGAGTTCTGGGTAGGCG No data
Right 1027778947 7:82499711-82499733 ACCGGCCGGCCCGCAAGCCCCGG No data
1027778944_1027778947 -7 Left 1027778944 7:82499695-82499717 CCCTGCACTGGGAGTGACCGGCC No data
Right 1027778947 7:82499711-82499733 ACCGGCCGGCCCGCAAGCCCCGG No data
1027778945_1027778947 -8 Left 1027778945 7:82499696-82499718 CCTGCACTGGGAGTGACCGGCCG No data
Right 1027778947 7:82499711-82499733 ACCGGCCGGCCCGCAAGCCCCGG No data
1027778942_1027778947 0 Left 1027778942 7:82499688-82499710 CCGCTGGCCCTGCACTGGGAGTG No data
Right 1027778947 7:82499711-82499733 ACCGGCCGGCCCGCAAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027778947 Original CRISPR ACCGGCCGGCCCGCAAGCCC CGG Intergenic
No off target data available for this crispr