ID: 1027783498

View in Genome Browser
Species Human (GRCh38)
Location 7:82550177-82550199
Sequence AGCCATTGGAAGCCCGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027783493_1027783498 6 Left 1027783493 7:82550148-82550170 CCTTTCCACTTCATATGTAGGGA No data
Right 1027783498 7:82550177-82550199 AGCCATTGGAAGCCCGGGCATGG No data
1027783494_1027783498 1 Left 1027783494 7:82550153-82550175 CCACTTCATATGTAGGGAATAAG No data
Right 1027783498 7:82550177-82550199 AGCCATTGGAAGCCCGGGCATGG No data
1027783489_1027783498 22 Left 1027783489 7:82550132-82550154 CCTTTACATGATAAGCCCTTTCC No data
Right 1027783498 7:82550177-82550199 AGCCATTGGAAGCCCGGGCATGG No data
1027783491_1027783498 7 Left 1027783491 7:82550147-82550169 CCCTTTCCACTTCATATGTAGGG No data
Right 1027783498 7:82550177-82550199 AGCCATTGGAAGCCCGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027783498 Original CRISPR AGCCATTGGAAGCCCGGGCA TGG Intergenic
No off target data available for this crispr