ID: 1027785427

View in Genome Browser
Species Human (GRCh38)
Location 7:82574003-82574025
Sequence CTAGTCCTGCCCTTGACACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027785423_1027785427 -2 Left 1027785423 7:82573982-82574004 CCATGATCCAATTATGTCCACCT No data
Right 1027785427 7:82574003-82574025 CTAGTCCTGCCCTTGACACATGG No data
1027785424_1027785427 -9 Left 1027785424 7:82573989-82574011 CCAATTATGTCCACCTAGTCCTG No data
Right 1027785427 7:82574003-82574025 CTAGTCCTGCCCTTGACACATGG No data
1027785421_1027785427 0 Left 1027785421 7:82573980-82574002 CCCCATGATCCAATTATGTCCAC No data
Right 1027785427 7:82574003-82574025 CTAGTCCTGCCCTTGACACATGG No data
1027785420_1027785427 1 Left 1027785420 7:82573979-82574001 CCCCCATGATCCAATTATGTCCA No data
Right 1027785427 7:82574003-82574025 CTAGTCCTGCCCTTGACACATGG No data
1027785422_1027785427 -1 Left 1027785422 7:82573981-82574003 CCCATGATCCAATTATGTCCACC No data
Right 1027785427 7:82574003-82574025 CTAGTCCTGCCCTTGACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027785427 Original CRISPR CTAGTCCTGCCCTTGACACA TGG Intergenic
No off target data available for this crispr