ID: 1027787191

View in Genome Browser
Species Human (GRCh38)
Location 7:82594998-82595020
Sequence CAGACTGAAGGGTAGGACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027787187_1027787191 -6 Left 1027787187 7:82594981-82595003 CCAGGTGAGGAACAAAACAGACT No data
Right 1027787191 7:82594998-82595020 CAGACTGAAGGGTAGGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027787191 Original CRISPR CAGACTGAAGGGTAGGACTG TGG Intergenic
No off target data available for this crispr