ID: 1027793568

View in Genome Browser
Species Human (GRCh38)
Location 7:82662325-82662347
Sequence GTTCCTGGGGGGAAATGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027793553_1027793568 12 Left 1027793553 7:82662290-82662312 CCCCCACCTACATGCTGACCCAG No data
Right 1027793568 7:82662325-82662347 GTTCCTGGGGGGAAATGGGGAGG No data
1027793559_1027793568 -7 Left 1027793559 7:82662309-82662331 CCAGCAGACTCTCTATGTTCCTG No data
Right 1027793568 7:82662325-82662347 GTTCCTGGGGGGAAATGGGGAGG No data
1027793555_1027793568 10 Left 1027793555 7:82662292-82662314 CCCACCTACATGCTGACCCAGCA No data
Right 1027793568 7:82662325-82662347 GTTCCTGGGGGGAAATGGGGAGG No data
1027793554_1027793568 11 Left 1027793554 7:82662291-82662313 CCCCACCTACATGCTGACCCAGC No data
Right 1027793568 7:82662325-82662347 GTTCCTGGGGGGAAATGGGGAGG No data
1027793556_1027793568 9 Left 1027793556 7:82662293-82662315 CCACCTACATGCTGACCCAGCAG No data
Right 1027793568 7:82662325-82662347 GTTCCTGGGGGGAAATGGGGAGG No data
1027793557_1027793568 6 Left 1027793557 7:82662296-82662318 CCTACATGCTGACCCAGCAGACT No data
Right 1027793568 7:82662325-82662347 GTTCCTGGGGGGAAATGGGGAGG No data
1027793558_1027793568 -6 Left 1027793558 7:82662308-82662330 CCCAGCAGACTCTCTATGTTCCT No data
Right 1027793568 7:82662325-82662347 GTTCCTGGGGGGAAATGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027793568 Original CRISPR GTTCCTGGGGGGAAATGGGG AGG Intergenic
No off target data available for this crispr