ID: 1027795290

View in Genome Browser
Species Human (GRCh38)
Location 7:82685407-82685429
Sequence TTCATTAAGCACTATGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027795287_1027795290 16 Left 1027795287 7:82685368-82685390 CCTCTGTGGTTCTTAACATGTCA No data
Right 1027795290 7:82685407-82685429 TTCATTAAGCACTATGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027795290 Original CRISPR TTCATTAAGCACTATGACCT GGG Intergenic
No off target data available for this crispr