ID: 1027798012

View in Genome Browser
Species Human (GRCh38)
Location 7:82718103-82718125
Sequence CCAAAGAGACTATACTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027798012_1027798020 23 Left 1027798012 7:82718103-82718125 CCACCCCAGTATAGTCTCTTTGG No data
Right 1027798020 7:82718149-82718171 CACAACTGGGAACCAGCAGATGG No data
1027798012_1027798019 10 Left 1027798012 7:82718103-82718125 CCACCCCAGTATAGTCTCTTTGG No data
Right 1027798019 7:82718136-82718158 GTTTTGAGCTAAACACAACTGGG No data
1027798012_1027798018 9 Left 1027798012 7:82718103-82718125 CCACCCCAGTATAGTCTCTTTGG No data
Right 1027798018 7:82718135-82718157 TGTTTTGAGCTAAACACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027798012 Original CRISPR CCAAAGAGACTATACTGGGG TGG (reversed) Intergenic
No off target data available for this crispr