ID: 1027802019

View in Genome Browser
Species Human (GRCh38)
Location 7:82766182-82766204
Sequence GCCAAGGCTGCCACTCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027802019_1027802021 16 Left 1027802019 7:82766182-82766204 CCTTTGAGAGTGGCAGCCTTGGC 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1027802021 7:82766221-82766243 TCAAGAGTCTCAGTAGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027802019 Original CRISPR GCCAAGGCTGCCACTCTCAA AGG (reversed) Intronic
901083876 1:6599065-6599087 CCCAAGACTGCGACTCTAAACGG - Exonic
901131533 1:6964511-6964533 GCCATGGCTGCCTCTCTCCCAGG + Intronic
901183742 1:7358948-7358970 GCCAAAGCTGCCAGGCTCCAGGG - Intronic
902532148 1:17097418-17097440 CACAAGACTGCCTCTCTCAAGGG - Intronic
902664698 1:17929355-17929377 TCCATCGCTGCCACCCTCAATGG + Intergenic
903185524 1:21626765-21626787 GCCAAGGCGGCTACTCCCAGAGG - Intronic
903280748 1:22248628-22248650 CCCAGGGCTTCCACTCTCATGGG - Intergenic
904418660 1:30377693-30377715 GCCAAGGCTGTCCTTCTCAGAGG + Intergenic
904474603 1:30756908-30756930 GCCAAGGCTGCCCCTCTGCCTGG - Intronic
907418813 1:54332773-54332795 GCCAAAGCTGCCACTCAACAAGG + Intronic
907422075 1:54354364-54354386 GCCAATGCTGGGACCCTCAATGG + Intronic
907598804 1:55745970-55745992 GCTCAGGCTACCACTCTGAAAGG - Intergenic
908123627 1:61008570-61008592 TCCAGGGCTGCCACTCACATGGG - Intronic
908801130 1:67881884-67881906 TCCAAGCCTGCCTCTTTCAATGG - Intergenic
911475592 1:98368177-98368199 GCCAGAGCTAGCACTCTCAATGG + Intergenic
919183973 1:194120420-194120442 GCTTAGGCTGCCCTTCTCAAAGG + Intergenic
919685570 1:200480091-200480113 GCCAATGCTGAGAGTCTCAAAGG + Intergenic
921671679 1:217931860-217931882 GAGAAGGCTGCTAATCTCAATGG - Intergenic
922923238 1:229326684-229326706 GCCCAGCTGGCCACTCTCAAAGG + Intronic
1064807152 10:19148199-19148221 GCCAAGGCAGTGATTCTCAAAGG + Intronic
1066614813 10:37283724-37283746 GCCAAGAGTGGAACTCTCAAAGG - Intronic
1067348694 10:45456529-45456551 TCCAGGGCTTCCACTCTGAAAGG + Exonic
1067756851 10:49011906-49011928 GCCAATGCTGCCACTGCCATGGG + Intergenic
1067793486 10:49304669-49304691 GCCAAGGCTGGCACCCTCCGGGG + Intronic
1068785091 10:60963437-60963459 GCAAAGGGTGCAACTTTCAAAGG - Intronic
1074926734 10:118080719-118080741 GACAAGCTTGCCCCTCTCAAAGG - Intergenic
1076483729 10:130802068-130802090 GCCCTGGCTGCCATTCCCAACGG - Intergenic
1076695596 10:132245903-132245925 GCCAAAGCTGCCCTTCCCAATGG + Exonic
1077725831 11:4674126-4674148 GCAAAGGCTGACACTCTCTGTGG - Intergenic
1078315383 11:10289596-10289618 GCCAGGCCTGACACTCCCAAGGG - Intronic
1082073884 11:47961590-47961612 CCAAAGGCTGCCACACTGAAAGG - Intergenic
1083353543 11:62048198-62048220 GCCCAGGCTTTCACTGTCAAAGG + Intergenic
1083355403 11:62062541-62062563 GCCCAGGCTTTCACTGTCAAAGG + Intergenic
1084888574 11:72225284-72225306 GCCAAGGCTCCCACTCTGGGGGG - Intronic
1085688161 11:78644460-78644482 GTTAATGCTGCCACTCTCAGGGG + Intergenic
1090444917 11:126756037-126756059 TCTAAAGCTGCCACTCTCAATGG - Intronic
1090666565 11:128918561-128918583 GAAAAGGCTTCCATTCTCAAAGG - Exonic
1092231713 12:6779332-6779354 GCCCTGGCTGGCCCTCTCAAGGG + Intergenic
1094145712 12:27226519-27226541 CCCAAGGCAACCACTCCCAAAGG + Intergenic
1095618883 12:44225436-44225458 GCCAAGGTTGAAACTATCAAAGG + Intronic
1095825905 12:46530744-46530766 GCCGAGCCTGACACTCCCAATGG + Intergenic
1096995949 12:55838383-55838405 ACCAAGGCTGCCACGCTCTAAGG - Intronic
1099758257 12:86884333-86884355 CCAAAGCCTGTCACTCTCAAAGG - Intergenic
1102233452 12:111279294-111279316 GCCAAGGCTCCAAGTCTCATAGG - Intronic
1103013532 12:117476421-117476443 GCCCAGGCTGTGGCTCTCAATGG + Intronic
1105851561 13:24340317-24340339 GAAAAGGCTGTCACTCTCTAAGG + Intergenic
1106226555 13:27790822-27790844 GCCAAGGCTCCCCCACTCTAGGG - Intergenic
1107699140 13:43030298-43030320 ACCAAGATTGCCACCCTCAAGGG + Intronic
1108346564 13:49552197-49552219 TGCAAAGCTGCCACTCTCACAGG + Exonic
1114036857 14:18637224-18637246 GCCATGGCTGCCGGTTTCAATGG + Intergenic
1114121782 14:19677819-19677841 GCCATGGCTGCCGGTTTCAATGG - Intergenic
1114201544 14:20525720-20525742 GCCAGGGCTGCCCCTCTACATGG + Intergenic
1118769298 14:68931127-68931149 ACCAAGGCTGAGATTCTCAATGG + Intronic
1119223978 14:72929926-72929948 GCCATGGCTGCTGCTCTCCATGG + Intronic
1119689519 14:76660484-76660506 GCCCAAGCTGCCACTGTCACGGG + Intergenic
1121354942 14:93206736-93206758 TCCAAGTCTGCCACTCTACACGG + Intronic
1121789373 14:96687403-96687425 GCCAAGGGAGCCCCTTTCAAAGG + Intergenic
1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG + Intronic
1124168327 15:27349534-27349556 TCCTTGGCTTCCACTCTCAATGG + Intronic
1125261672 15:37832926-37832948 GCCAAGGCCACCACTCTGAAGGG + Intergenic
1125752171 15:42036572-42036594 GCCTAGCCTGACACTCCCAAAGG + Intronic
1128129351 15:65215234-65215256 GCCAAGGCTTCCATTCTTCAAGG - Intergenic
1129060384 15:72856256-72856278 GCCAAGGCTGACACTCAGACAGG + Intergenic
1131172947 15:90191283-90191305 GCTGAGGCTGCAACTCTCATGGG - Intronic
1131750179 15:95497889-95497911 GCCCAGGCTCCCACTGTTAATGG - Intergenic
1132314081 15:100878433-100878455 GTCAAGGCTGCCCCGCTCGAGGG + Intronic
1132497515 16:270861-270883 GCCCTGGCTGCCACTCTCGATGG - Intronic
1132651595 16:1023642-1023664 TCCGAGGCTGCCTCCCTCAAGGG - Intergenic
1133288796 16:4704365-4704387 GCCAAGGCTGCTGGTCTCACAGG - Intronic
1134444360 16:14319716-14319738 GCCAGGCCTGCCCCTCTCAGGGG - Intergenic
1135206940 16:20492267-20492289 GCCAAGCCTGACACTCCCAACGG + Intergenic
1135211945 16:20531365-20531387 GCCAAGCCTGACACTCCCAACGG - Intergenic
1135500440 16:22991325-22991347 TCCAAAGTTGCCACTCTCAGAGG + Intergenic
1136070067 16:27782331-27782353 TCCCAGGCTGCCACTGTCAGGGG + Intergenic
1136126315 16:28184181-28184203 GACAAGGCTTCCATTCCCAAAGG + Intronic
1139273229 16:65702988-65703010 GCCTAGCTTGCCACACTCAAGGG + Intergenic
1139517273 16:67459432-67459454 GGCATGGCTGCCCCTCTCAGGGG + Intronic
1145980542 17:29008583-29008605 ACCCAGACTGCCACTTTCAAAGG - Intronic
1146266409 17:31455916-31455938 GCCCAGGATGGCACTCTCAGCGG - Intronic
1146445529 17:32929712-32929734 GCCAAGGAAGCCTTTCTCAAAGG - Intronic
1151869786 17:76828524-76828546 GTCCAGGCTGCCTCTCTCCATGG + Intergenic
1152198847 17:78933651-78933673 GCCAAGGCTGCCCGGCTCAGGGG - Intergenic
1153048283 18:876888-876910 GCCTAGGCCACCACTCTCACAGG - Intergenic
1155342197 18:24823960-24823982 GTAAAGTCTGCCACTCACAAAGG - Intergenic
1155747603 18:29378928-29378950 GCCAAGGCTGACTCTGTCATTGG - Intergenic
1156088061 18:33432125-33432147 GAAAAGGCTGGTACTCTCAATGG + Intronic
1156473415 18:37391300-37391322 GGCAAAGCTGCCCCTCTCTAAGG + Intronic
1158514387 18:58119230-58119252 TCCCAGGCTTCCACTCTCCATGG - Intronic
1164846583 19:31437871-31437893 TCCATGGCTGCCACTCACCATGG + Intergenic
1166212289 19:41314699-41314721 GCCAAGGCTGCAATTTTAAATGG - Intronic
1168616302 19:57839779-57839801 GCCCAGGGTGCCACTCTTTAGGG - Intronic
1168620566 19:57876253-57876275 GCCCAGGGTGCCACTCTTTAGGG + Intronic
928950470 2:36808964-36808986 GCCATGGCTGCCCATCTGAAGGG + Exonic
934138543 2:89021153-89021175 GCAAAGGGTGCAACTCTTAAGGG + Intergenic
934230700 2:90179414-90179436 GCAAAGGGTGCAACTCTTAAGGG - Intergenic
935326979 2:101946350-101946372 GCCAAGGCAGCCACACTGAGAGG + Intergenic
935328574 2:101960123-101960145 GCCAAGGCTCACACTCCCAGTGG - Intergenic
936864231 2:117058471-117058493 GCCAAGGCAGCCACTCTTTAGGG + Intergenic
937869796 2:126778751-126778773 GGCAAAGCTGCCAGTCCCAATGG - Intergenic
938120304 2:128628434-128628456 GCCAAGGCTGCCACCTGCCATGG - Intergenic
938139404 2:128783679-128783701 ACCATGGTTTCCACTCTCAAGGG + Intergenic
939397568 2:141650526-141650548 ACCATGGCTGCCACTCAAAATGG + Intronic
939453346 2:142400818-142400840 GCCAAGGCTCTCATTCTCCAGGG - Intergenic
941688375 2:168470949-168470971 CCCAAGGCTGCCTCGCTCAGAGG + Intronic
941820637 2:169840822-169840844 GCTAAGGCTGCCACTCCCAAAGG - Intronic
942607085 2:177703920-177703942 GCAAAGGCAGCCACTGTCTATGG + Intronic
1169635689 20:7689169-7689191 GCTCAGGCTGCCACTCTGGAGGG + Intergenic
1170244846 20:14209223-14209245 GCCAAAGCTGCCATTCTCTCTGG + Intronic
1171137423 20:22709022-22709044 GCCAAGGCTGCCACTGGAAGAGG + Intergenic
1175521202 20:59603941-59603963 CCCAGGGCTGCCACTCACAGAGG - Intronic
1175922423 20:62456358-62456380 GGCAAGGCTGCCCCTCTGCAGGG - Intergenic
1177942302 21:27425732-27425754 GCCAGGGCTGTCATTCTCAGAGG + Intergenic
1178700307 21:34827733-34827755 ACCTAGGCTGCCATTCTGAAGGG + Intronic
1180460981 22:15564272-15564294 GCCATGGCTGCCGGTTTCAATGG + Intergenic
1180972593 22:19823110-19823132 CCCAACCCTGCCTCTCTCAAGGG + Intronic
1182002594 22:26932804-26932826 GCAAAAGCTGAGACTCTCAATGG + Intergenic
1182132092 22:27862008-27862030 GCCAAAGCTGCCTCTCCCACGGG + Intronic
1182235735 22:28874963-28874985 CCCAAGGCCACCACTCCCAAGGG + Intergenic
1183014188 22:34972576-34972598 GCCAGGTCAGCCACTCTCAGTGG - Intergenic
1184435643 22:44473492-44473514 GCTCAGGCTGCCACTCTAGAAGG + Intergenic
1185263855 22:49887075-49887097 GCCAAGGCTACCGTTCTCAGTGG - Exonic
951710790 3:25583515-25583537 GCCAGGGCTGGCACTTTCACAGG + Intronic
960648239 3:119914486-119914508 ACCAAGTCAGTCACTCTCAATGG + Intronic
961349619 3:126291606-126291628 GCCGGGGCTGCCACTCTCCCAGG + Intergenic
963839710 3:150093035-150093057 TCCAAGGCTCCGACTCTCACTGG - Intergenic
966275075 3:178155754-178155776 TCCAAAGCTGGCACTCTCACTGG - Intergenic
968048801 3:195639549-195639571 GCCAAGGCTGGCATCCTGAAGGG - Intergenic
968098600 3:195950078-195950100 GCCAAGGCTGGCATCCTGAAGGG + Intergenic
968305816 3:197650375-197650397 GCCAAGGCTGGCATCCTGAAGGG + Intergenic
971159700 4:24121211-24121233 GCCAAAGCTGGCTCTCTGAAGGG - Intergenic
978912576 4:114082091-114082113 GCCTAGGCTGCCACACTCTCTGG + Intergenic
979448391 4:120840370-120840392 GCCAAGCCTGACATTCCCAACGG - Intronic
985505281 5:276028-276050 GCCAAGGCTGGCATCCTGAAGGG - Intronic
985575974 5:673677-673699 GCCAAGGCTGGCACACCCCAAGG + Intronic
985742846 5:1629592-1629614 GCCAAGGCTGGCATCCTGAAGGG + Intergenic
986291791 5:6405801-6405823 ACCAAGGCTGCCACTAACGAGGG - Intergenic
988790727 5:34604996-34605018 GAGAAGACTGCCACTCTCAGTGG - Intergenic
989146590 5:38256935-38256957 CCCAAGGCTGCTAGTCTCAAAGG - Intergenic
990301986 5:54458558-54458580 TCCAGGGCTGCCACTCTCACAGG + Intergenic
991915646 5:71602525-71602547 GCCAATGATGCCACCGTCAAAGG + Exonic
995585289 5:113642412-113642434 GCTCAGGCTGCCACTCTGGATGG + Intergenic
997195039 5:131973650-131973672 GCCAAAGCAGCCATTCTCACTGG + Intronic
997384210 5:133459704-133459726 GCCAAGGCTACCTCTCTCATGGG + Intronic
999361393 5:150989321-150989343 GCCATGGCTGCCAATCTCATAGG - Intergenic
1001978498 5:176020995-176021017 ACCAAGACAGCCACTCTCTAGGG + Intronic
1002238919 5:177822767-177822789 ACCAAGACAGCCACTCTCTAGGG - Intergenic
1003402196 6:5799819-5799841 GCCCACGCAGCCACTCTCAGGGG + Intergenic
1005779050 6:29169151-29169173 ACCAAGATTGCCACTCTCTAAGG + Intergenic
1006374017 6:33662137-33662159 GCCATGGCTGCCCCTCTCTCAGG - Intronic
1006785345 6:36662892-36662914 GCCAAGGCTGCCCCACCCTAGGG + Intergenic
1011161829 6:84399793-84399815 CCCAGGGCTGGCTCTCTCAAAGG - Intergenic
1014791386 6:125676303-125676325 GCCAAGGTGAGCACTCTCAAGGG - Intergenic
1018030672 6:159838677-159838699 GGCCAGGTTGCCACTCTCATGGG - Intergenic
1018055291 6:160047086-160047108 TCCAAGGCTGCCACACTGAAGGG - Intronic
1019446875 7:1075971-1075993 CCCGGGGCTGCCACTCTCCAGGG + Intronic
1019485639 7:1288085-1288107 GCCACGCCTGCCACCCTCAGGGG + Intergenic
1019557678 7:1640854-1640876 GCCCAGGCTGCCCCCCTCAGTGG + Intergenic
1019661177 7:2224848-2224870 GCAAAGGGTGCCGGTCTCAATGG - Intronic
1024567231 7:50691351-50691373 CCCAGCTCTGCCACTCTCAAGGG + Intronic
1025095497 7:56092687-56092709 GTCAATGCTGCCACTCTCCCTGG + Intronic
1026873822 7:73868787-73868809 CCCTCGGCTGCCACTCACAATGG + Intergenic
1027802019 7:82766182-82766204 GCCAAGGCTGCCACTCTCAAAGG - Intronic
1028318707 7:89435393-89435415 ACCATGGCTGCCAATCTCAAAGG + Intergenic
1032990351 7:137387980-137388002 GCCAAAGCAGCCATTCTGAAAGG + Intronic
1035566333 8:643605-643627 GCCAAGTCTGCCTTCCTCAAAGG + Intronic
1036963402 8:13270371-13270393 GTCAAGGCTGCCACTTGAAAGGG - Intronic
1040559752 8:48514147-48514169 GCCAGGGCCGCCACTCTCTGGGG + Intergenic
1041355879 8:56999613-56999635 GCAAATGCTGACACTCTAAATGG + Intergenic
1042488280 8:69370643-69370665 CTCAAGGCTGCTGCTCTCAAAGG + Intergenic
1048514865 8:135097182-135097204 GCCTGGGCTTCCACTCTCATGGG + Intergenic
1049391366 8:142373298-142373320 GGCCATGCTGCCACCCTCAAAGG + Intronic
1049786071 8:144451452-144451474 GCTAAGGCTGCTACTCACCACGG + Intronic
1051668145 9:19484510-19484532 CCCAAGGCTGCCAACCTCATGGG - Intergenic
1058898191 9:109418167-109418189 GCCTACGCTGCCACACTCCAGGG - Intronic
1059504182 9:114782917-114782939 GCCAAGGATGCCATCCTCACAGG - Intergenic
1061947511 9:133917009-133917031 GACGAGGTTGCCACTCTCACGGG + Intronic
1062339358 9:136087141-136087163 CCCAAGGCTGCCACTGTCCTGGG - Intronic
1187394267 X:18906419-18906441 GCCACGGCCTCCACTCTCAGGGG - Intronic
1187405121 X:18996805-18996827 CCCATGGCTGCCACTCCCCAAGG + Intronic
1187560980 X:20403433-20403455 GCCTAGACTGGCAGTCTCAAAGG - Intergenic
1188809298 X:34633155-34633177 GACAAAGCTGCTACTCTCATGGG + Intronic
1191864393 X:65692039-65692061 GCTAAGGATGCCAAACTCAATGG - Intronic
1192529947 X:71875289-71875311 GCCAAGGGTGCCTCCCTCAGGGG - Intergenic